All tmRNA Alignment 08-JUL-2014 by Kelly Williams and Corey Hudson for The tmRNA Website, with base-pairing color-coded as in home page diagram. Underline marks the predicted reading frame for the proteolysis-inducing peptide tag. Lowercase marks segments not homologous to tmRNA, intervening segments that are absent in the mature tmRNA, and portions of the expected 3-prime CCA tail that are not encoded in the genome.

GAMMA-PROTEOBACTERIA
Xanthomonadales
Xfa1t1      GGGGGUG-----CACUGGC--UUCGACGGGGGUCAC-----AAAAUCACUUGGUGCAUGC--CGAGG-GGGCCGCUUU-CCUCGUAAAUCC---------AGCAGC---AAACUUAUAGUUGCCAACGAAGACAAC---------------------------------------------------------UUCGCUGUAGCCGCUUAA--------------------------GGCUUAAGC-------------------------CUCGAAACUGCUUGUG------------------UCCGUGCUCGCAG-CGUAGAG----------------------------------------------------------UCAUCAUCACGGAACC--GCUGAGACGUGGCC-----------GUCUGCCCAUCCUCGGU---UAAAUCUA--GCAGAC-UG------GUUUCCGGGUGCGCUUUGCCUGUCGU-GCUGCCCGGCGAC----GAGACCUA---ACGGCGAGGAUAAGCA-UGUAG----------------------GGCCGGGGAUGG------AGUACUUUCGGAC-GGCGGUUCGAUUCCGCC-CACCUCCACCA Xfa1t1
Xfa2t3      GGGGGUG-----CACUGGC--UUCGACGGGGGUCAC-----AAAAUCACUUGGUGCAUGC--CGAGG-GGGCCGCUUU-CCUCGUAAAUCC---------AGCAGC---ACACUUAUAGUUGCCAACGAAGACAAC---------------------------------------------------------UUCGCUCUAGCCGCUUAA--------------------------GGCUUAAGC-------------------------CUCGAAACUGCUUGUG------------------UCCGUGCUCGCAG-CGUAGAG----------------------------------------------------------UCAUCAUCACGGAACC--GCUGAGACGUGGCU-----------GUCUGCCCACACUUGGU---UAAAUCUA--GCAGAC-UG------GUUUCCGGGUGCGCUUUGCCUGUCGU-GCUGCCCGGCGAC----GAGACCUA---ACGGCCAGGAUAAGCA-UGUAG----------------------GGCCGGGGAUGG------AGUACUUUCGGAC-GGCGGUUCGAUUCCGCC-CACCUCCACCA Xfa2t3
Xfa8t1      GGGGGUG-----CACUGGC--UUCGACGGGGGUCAC-----AAAAUCACUUGGUGCAUGC--CGAGG-GGGCCGCUUU-CCUCGUAAAUCC---------AGCAGC---ACACUUAUAGUUGCCAACGAAGACAAC---------------------------------------------------------UUCGCUAUAGCCGCUUAA--------------------------GGCUUAAGC-------------------------CUCGAAACUGCUUGUG------------------UCCGUGCUCGCAG-CGUAGAG----------------------------------------------------------UCAUCAUCACGGAACC--GCUGAGACGUGGCC-----------GUCUGCCCACCCUUGGU---UAAAUCUA--GCAGAC-UG------GUUUCUGGGUGCGCUUUGCCUGUCGU-GCUGCCCGGCGAC----GAGACCUA---ACGGCCAGGAUAAGCA-UGUAG----------------------GGCCGGGGAUGG------AGUACUUUCGGAC-GGCGGUUCGAUUCCGCC-CACCUCCACCA Xfa8t1
Xfa9t4      GGGGGUG-----CACUGGC--UUCGACGGGGGUCAC-----AAAAUCACUUGGUGCAUGC--CGAGG-GGGCCGCUUU-CCUCGUAAAUCC---------AGCAGC---ACACUUAUAGUUGCCAACGAAGACAAC---------------------------------------------------------UUCGCUCUAGCCGCUUAA--------------------------GGCUUAAGC-------------------------CUCGAAACUGCUUGUG------------------UCCGUGCUCGCAG-CGUAGAG----------------------------------------------------------UCAUCAUCACGGAACC--GCUGAGACGUGGCC-----------GUCUGCCCACCCUUGGU---UAAAUCUA--GCAGAC-UG------GUUUCCGGGUGCGCUUUGCCUGUCGU-GCUGCCCGGCGAC----GAGACCUA---ACGGCCAGGAUAAGCA-UGUAG----------------------GGCCGGGGACGG------AGUACUUUCGGAC-GGCGGUUCGAUUCCGCC-CACCUCCACCA Xfa9t4
Xca4t30     GGGGGUG-----CACUGGU--UUCGACGGGGGUCGC-----GAAGUCGCUUGGCGCAUGC--CGAGG-GGGCAGCUUU-CCUCGUUAAUCC---------AGCAGC---AAACUUUUAGUUGCCAACGACGACAAC---------------------------------------------UACGGUUCGGACUUCGCUAUCGCCGCUUAA--------------------UUGGCUUUAGUUGUAGUUCUACAGCCGCCUAAGGCGAACCCCCGAAACUACUUGUG------------------CCCGUGCUCGUAGAUGUAGGG----------------------------------------------------------UCAUUAUCACGGAACC--GCCGGUA-GUGGCU-----------GCCUGUCAGCUAUCGGU---UAGAUCAA--GCAGGC-UG------GUUUUCAGGUGCGCUUUGCCCGCCGU-GCUGCCUGGGAAC----GAGAUCUA---ACGGA-GGGAUAAGCA-UGUAG----------------------UGCUGGGGAUGG------AGUGCUUCCGGAC-GGCGGUUCGAUUCCGCC-CACCUCCACCA Xca4t30
Xca12t1     GGGGGUG-----CACUGGU--UUCGACGGGGGUCGC-----GAAGUCGCUUGGCGCAUGC--CGAGG-GGGCAGCUUU-CCUCGUUAAUCC---------AGCAGC---AAACUUUUAGUUGCCAACGAUGACAAC---------------------------------------------UACGGUUCGGACUCCGCUAUCGCCGCUUAA--------------------UUGGCUUUAGUUGUAGUUCUACAGCCGCCUAAGGCGAACCCCCGAACCUACUUGUG------------------CCCGUGCUCGUAGGUGUAGGG----------------------------------------------------------UCAUUAUCACGGAACC--AUCGGUA-GUGGCU-----------GCCUGUCAGCUACCGGU---CAGAUAAA--GCAGGC-UG------GUUUCCAGGUGCGCUUUGCCAACCGU-GCUGCCUGGAAAC----GAGAUCUA---ACGGA-GGGCUAAGCA-UGUAG----------------------UGCUGGGGAUGG------AGUGCUUCCGGAC-GGCGGUUCGAUUCCGCC-CACCUCCACCA Xca12t1
Xax1t75     GGGGGUG-----CACUGGU--UUCGACGGGGGUCGC-----GAAGUCGCUUGGCGCAUGC--CGAGG-GGGCAGCUUU-CCUCGUUAAUCC---------AGCAGC---AAACUUUUAGUUGCCAACGAUGACAAC---------------------------------------------UACGGUUCGGACUUCGCUAUCGCCGCUUAA--------------------UUGGCUUUAGUUGUAGUUCUACAGCCGCCUAAGGCGAACCCCCGAACCUACUUGUG------------------CCCGUGCUCGUAGGUGUAGGG----------------------------------------------------------UCAUUAUCACGGAACC--AUCGGUA-GUGGCU-----------GCCUGUCAGCUACCGGU---CAGAUAAA--GCAGGC-UG------GUUUCCAGGUGCGCUUUGCCAACCGU-GCUGCCUGGGAAC----GAGAUCUA---ACGGA-GGGCUAAGCA-UGUAG----------------------UGCUGGGGAUGG------AGUGCUUCCGGAC-GGCGGUUCGAUUCCGCC-CACCUCCACCA Xax1t75
Xor1t5      GGGGGUG-----CACUGGU--UUCGACGGGGGUCGC-----GAAGUCGCUUGGCGCAUGC--CGAGG-GGGCAGCUUU-CCUCGUUAAUCC---------AGCAGC---AAACUUUUAGUUGCCAACGAUGACAAC---------------------------------------------UACGGUUCGGACUUCGCUAUCGCCGCUUAA--------------------UUGGCUUUAGUUGUCGUUCUACAGCCGCCUAAGGCGAACCCCCGAACCUACUUGUG------------------CCCGUGCUCGUAGGUGUAGGG----------------------------------------------------------UCAUUAUCACGGAACC--AUCGGUA-GUGGCU-----------GCCUGUCAGCUACCGGU---UAGAUAAA--GCAGGC-UG------GUUUUCAGGUGCGCUUUGCCAACCGU-GCUGCCUGGGAAU----GAGAUCUA---ACGGA-GGGCUAAGCA-UGUAG----------------------UGCUGGGGAUGG------AGUGCUUCCGGAC-GGCGGUUCGAUUCCGCC-CACCUCCACCA Xor1t5
B1t15       NNNNNNN-----NNNNNNN--NNNNNNGCUGGUAAC-----GGAAUCCG-AAGUGCAUGC--CGAGG--UGUCAUGU--CCUCGUAAAACC---------UGUGACA--ACCAAGCUAGUUGCGAACGACUCCAAC---------------------------------------------------------UACGCCCUCGCCGCCUAA-------------------------AUCCCGGUGAG------------------------CGUCCAUCCUUUCAGU-----------------GCCGAUACUGGUUGGAAUGGGCG--------------------------------------------------------UCGACUCUUAUCGGAUC--GUGGUGAAGCCCG-------------CCCUUGGCCGAUCUGC---UAAAACUCUA-AGGGGAUAA-----GCGUUGGAGAUCCGU--GCCUGUC---CGGGAGCCAACGU----CGAAAACCAAA--GAUCAGGCUAAGCA-UGUAG----------------------AUCUGAGGGCUA------CGAUCUGGCGGAC-GCGGNNNNNNNNNNNNN-NNNNNNNNNNN B1t15
B1t34       NNNNNNN-----NNNNNNN--NNNNNNGCUGGUAAC-----GGAAUCCG-AAGUGCAUGC--CGAGG--UGUCAUGU--CCUCGUAAAUCC---------CGUGGCA--ACCAAGCUAGUUGCGAACGACUCCAAC---------------------------------------------------------UACGCCCUCGCCGCCUAA-------------------------AUCCCGGUGAG------------------------CGUCCAUCCUUUCGGU-----------------GCCGAUACCGGUUGGAAUGGGCG--------------------------------------------------------UCGACUCUUAUCGGCUC--GCGGUGAAGCCCG-------------CCCUUGGCCGAUCUGC---UAAAACCCUA-AGGGGAUAA-----GCGUUGGAGAUCCGU--GCCUGUC---CGGGAACCAACGU----CGAAAACCAAA--GAUCAGGCUAAGCA-UGUAG----------------------AUCUGAGGGCUA------CGAUCUGGCGGAC-GCGGNNNNNNNNNNNNN-NNNNNNNNNNN B1t34
Sma7t5      GGGGGUG-----CAUUGGU--UUCGACGGGGGUUGU-----GAAGUCGCCUGGCGCAUGC--CGAGG-GGGUAGCUUU-CCUCGUAAAUCC---------AGCUGC---AAAACUCUAGUUGCCAACGACGACAAC---------------------------------------------------------UACGCUCUGGCCGCUUAA--------------------------GGCCUAAGC-------------------------CUCGAAACCGCUUGUG------------------UCCAUGCUCGCGG-UGUAGAG----------------------------------------------------------UCACUAUCAUGGAAUC--GCGCUGG-GUGGCU-----------GCCUGUCAGUCCGGCAC---UAGAACACA-ACAGGC-UG------GUUCCCGGAUGCGCUUUGCACGCCGU-GCUGUUCGGGGAC----GAGAUCCA---ACGGU-GAGCUAAGCA-UGUAG----------------------UGCUGGGGAUGG------AGUGCCUUCGGAC-GGCGGUUCAAUUCCGCC-CACCUCCACCA Sma7t5
Cardiobacteriales
Dno1t4      GGGGGCG----UUCUUGGA--UUCGACGGGGAUUGCG------AGGCUCGAGGUGCAUGU--CGAGA---AUGAGAGAAUCUCGUUAAAUA---------CUUUCAA---AACUUAUAGUUGCAAACGACGACAAC---------------------------------------------------------UACGCUUUAGCGGCUUAA-------------------------UUCCCGCUU--------------------------UCGCUUACCUAGAUUU-----------------GUCUGUGGGUUUACCGUAAGCGA----------------------------------------------------------CAUUAACACAGAAUC--GCUGGUUAACGCG------------UCCGCUGUUA--AUCGGU--UAAA--UUA-AGCGGAAUC------GCUUGUAAAAUGCCU--GAGCGUU--GGCUGUUUAUGAGU----UAAACCUAAUU--AACUGCUCUAAACA-UGUAG----------------------UACCAAAAGUUA------AGGAUUCGCGGAC-GGGGGUUCAAAUCCCCC-CGCCUCCACCA Dno1t4
Thiotrichales
Ftu25t21    GGGGGCG----AAUAUGGU--UUCGACAUGAAUGUC-----AAAAUCU-AAGGUGCAUGC--CGAGG-AAGUACCGUAACCUCGUUAAUA-------ACAGUACAAAUGCCAAUAAUAACUGGCAACAAAAAAGCA---------------------AACCGCGUAGCGGCUAACGACAGCAACUUUGCUGCUGUUGCUAAAGCUGCCUAG--------------------------UCUAGCUUAAUAAUCUAGAUGCGC----------ACGGAUAUGAUAGUCUU----------------UCUUAUGACACUAUCUAUACAUCCGUUCA---------------------------------------------------UAUUCCGCAUAAGA----CGGUCUUUGCUUUUU-----------GUCUGGGAGUUAAGGCUG-UAUUUAA----CAGAC-UC------GCUAACUAUUACCCU--GGCUAAUUGGGGAAUAGUCAAGC----UAAACUCAAAUA-GAUUAGCCUAAGCA-UGUAG----------------------AUCCAAAGAUCU------AGAGUUUGUGGAC-GCGGGUUCAAAUCCCGC-CGCCUCCACCA Ftu25t21
Ftu7t9      GGGGGCG----AAUAUGGU--UUCGACAUGAAUGUC-----AAAAUCU-AAGGUGCAUGC--CGAGG-AAGUACCGUAACCUCGUUAAUA-------ACAGUACAAAUGCCAAUAAUAACUGGCAACAAAAAAGCA---------------------AACCGCGUAGCGGCUAACGACAGCAACUUUGCUGCUGUUGCUAAAGCUGCCUAG--------------------------UCUAGCUUAAUAACCUAGAUGCGC----------ACGGAUAUGAUAGUCUU----------------UCUUAUGACACUAUCUAUACAUCCGUUCA---------------------------------------------------UAUUCCGCAUAAGA----CGGUCUUUGCUUUUU-----------GUCUGGGAGUUAAGGCUG-UAUUUAA----CAGAC-UC------GCUAACUAUUACCCU--GGCUAAUUGGGGAAUAGUCAAGC----UAAACUCAAAUA-GAUUAGCCUAAGCA-UGUAG----------------------AUCCAAAGAUCU------AGAGUUUGUGGAC-GCGGGUUCAAAUCCCGC-CGCCUCCACCA Ftu7t9
Tcr1t1      GGGGAUG-----CACUGGU--UUCGACGGGGAGUAC-----AAAGUUU-AGGAUGCAUGU--CGUGC--CUGAAUGAU-GCACGUAAAUCU-------UUAUUUCA--AUUUGUUAUAGUUGCAAACGACGAUAAC---------------------------------------------------------UACGCUCUAGCGGCUUAA-----------------------UCCCGCUAG----------------------------CGCAGACUGGGACCGUUG--------------UUCGUGGCACCCAGCUCUGUG----------------------------------------------------------UCGACUCACACGGAAUC---GUCGGGUCUUAUGU------------GUUUGGAUAAGACUUGAC-UAAACUUAA--CAAAC-UC------GCUUAAUGUGAUCCCUGCUGGCCGGGCAGCAUUAAGU-------UAAAAUAAUA---GAC-CAAAUAAACA-UGUAG----------------------AGUUUUAAAUGG------AGGCUUCUCGGAC-GGCGGUUCGACUCCGCC-CAUCUCCACCA Tcr1t1
Chromatiales
Noc2t3      GGGGGCG-----ACCUGGC--UUCGACGCGGGUAGC-----AAAACCU-AAGGGGCAUGC--CGAGG-UGCAGUGA---CCUCGUUAAUCA---------CGCUGCA---ACAUUAUAGUUGCCAACGACGACAAC---------------------------------------------------------UACGCACUCGCUGCUUAA------------------------AACCCAGUAGGGUGC---------------------CGUCUGACUGAAGCCGU----------------GCUUGUGCGUUCAGAUUUCAGGCG-------------------------------------------------------UCGAUUCUCACAAGAUC--GCGGUGAA-GUUC-------------UCCCAGGGCAGACCCGC--UAAAACUUUA-CUGGGAUC------GCCGUAUGUUUUCCU-UGCCCGUC--GGGUAGCAUGCGGU----UAAAUUAAU----GACUGGGCUAUGCA-UGUAG----------------------AACCGAAGGCGG------AGUACUUGUGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Noc2t3
Legionellales
Lpn12t13    GGGGGCG-----ACCUGGC--UUCGACGUGGGUUGC-----AAAACCG-GAAGUGCAUGC--CGAGA-AGGAGAUC---UCUCGUAAA-UA---------AGACUCA-AUUAAAUAUAAAUGCAAACGAUGAAAAC---------------------------------------------UUUGCUGGUGGGGAAGCUAUCGCUGCCUAA---------UAAGCACUUUAGUUAAACCAUCACUGUGUACUGGCCAAUAAACCCAGUAUCCCGUUCGACCGAGCCC-----------------GCUUAUCGGUAUCGAAUCAACGG--------------------------------------------------------UCAUAAGAGAUAAGCUA--GCGUCCUAAUCUA--------------UCCCGGGUUAUGGCGC---GAAACUCA---GGGAAUC------GCUGUGUAUCAUCCU--GCCCGUC--GGAGGAGCCACAGU----UAAAUUCAAAA--GACAAGGCUAUGCA-UGUAG----------------------AGCUAAAGGCAG------AGGACUUGCGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Lpn12t13
Cbu9t8      GGGGGCG-----ACCAGGC--UUCGACGUGGAUCCU-----GAAACCC-GAGACGCAUGU--CGAGC-CGGCAACGAAGGCUCGUAAAUCCAU-------CAGUUGCA--AACAGAUAGUUGCAAACGAUAGUAAU---------------------------------------------------UAUCUCCAAGAAGCUUACGCAUAA-------------------------AGCUUCUU---------------------------CCGUUGCUGGGAUUC------------------GCUUAUAGAUCCCUACCAACGG---------------------------------------------------------CCAUAGCAUAUAAGCUC--GCCCUCAAGCAUG--------------GCUCAUGACUUGAAGGU-UAAACAGAA---GAGC-UC------GCAGUCAAUUUCCCCU-GCACGUC--GGGCGAUUGACUGU----UAAAUCAUA----GACGAUGCUAAGCA-UGUAG----------------------UGUCAACGGCGG------AUGAUUUACGGAC-GCGGGUUCAAUUCCCGC-CGCCUCCAuca Cbu9t8
Methylococcales
Mca2t1      GGGGGCG-----ACAUGGC--UUCGACGUGGAUCGC-----GAAACCU-GAGGUGCAUGC--CGAGG-UGCAGAUGA--CCUCGUAAAUC----------CAUCUGCA-AACCAAAUAAACGCCAACGACGACGUU---------------------------------------------------------UACGCACUGGCCGCUUAA-------------------------GCCGGCCGG--------------------------CCUCUGAUCAGCAGCUC----------------GCUUACAAGCGGCUGGUUGGGG-------------------------------------------------------GUAACCCAAUUGUAAGCUC--GCGCUGAAGUCUG--------------UCCGGGGCCGAAGCGC--UAAAACCCAA--CGGAAUC------GCCGUCCGUCUUCCCU-GCCACUC--GGGUAGCGUCCGGC----UAAAUCAAUA----GAGUGGAUACGCA-UGUAG----------------------AACCGAUGGCAG------AGGAUUUGCGGAC-GCGGGUUCAAUUCCCGC-CGCCUCCACCA Mca2t1
Pseudomonadales
Avi6t3      GGGGCCG-----AUUAGGA--UUCGACGCCGGUAAC-----GAAACUU-GAGGGGCAUGC--CGAGUU-GGUGGCAG-AACUCGUAAAUCCA-------CUGCUACA---AACUCAUAGUUGCCAACGACGACAAC---------------------------------------------------------UACGCUCUGGCGGCUUAA---------------------------UGC-CCCAG------------------------CAGUCUCCAGGGGAU------------------GCCUGUAAACCCGAAGAGACUG---------------------------------------------------------UCAGAUAGAACAGGAUC--GCCGCCAAGUUC-------------GCUGUAGACGUAACGGC---UAAAACUCA-UACAGC-UC---------GCCCAAAGCACCCUGCCCGUCGGGCCGCAAUGGGU-------UAACUCAAUA--GACAGGGCUAAGCA-UGUAG----------------------AACCGAUAGCGG------AGAGCUGGCGGAC-GGGGGUUCAAAUCCCCC-CGGCUCCACCA Avi6t3
Pae2t72     GGGGCCG-----AUUAGGA--UUCGACGCCGGUAAC-----AAAACUU-GAGGGGCAUGC--CGAGCU-GGUAGCAG-AACUCGUAAAUUCG-------CUGCUGCA---AACUUAUAGUUGCCAACGACGACAAC---------------------------------------------------------UACGCUCUAGCUGCUUAA---------------------------UGCGGCUAG------------------------CAGUCGCUAGGGGAU------------------GCCUGUAAACCCGAAACGACUG---------------------------------------------------------UCAGAUAGAACAGGAUC--GCCGCCAAGUUC-------------GCUGUAGACGUAACGGC---UAAAACUCA-UACAGC-UC--------GCUCCA-AGCACCCUGCCACUCGGGCGGCGCGGAGU-------UAACUCAGUA--GAGCUGGCUAAGCA-UGUAG----------------------AACCGAUAGCGG------AGAGCUGGCGGAC-GGGGGUUCAAAUCCCCC-CGGCUCCACCA Pae2t72
Psy58t43    GGGGCCG-----AUUUGGA--UUCGACGCCGGUGAU-----GAAACUU-UAGGUGCAUGC--CGAGUU-GGUAACAG-AACUCGUAAAUCCA-------CUGUUGCA-ACUUUCUAUAGUUGCCAAUGACGAAAAC---------------------------------------------------UACGGUGCUCAACUAGCUGCGUAA------------------------GCAGCCUAGCCGCACUUCUGGUAGCUUCGGCUCCAGCAAUCAUCAGGGGAU------------------GCCUGUAAACCCAAAAUGAUUG---------------------------------------------------------UCAUAUAGAACAGGAUC--GUCGCCUAGUAC-------------GUUGUGGACGAAGCGAC---UAAAACUUA-CGCAAC-UC---------GCCCAAUGCACCCUGCCCGUCGGGUCGCUGAGGGU-------UAACUUAAUA--GACACGGCUACGCA-UGUAG----------------------UACCGACAGCGG------AGUACUGGCGGAC-GGGGGUUCAAAUCCCCC-CGGCUCCACCA Psy58t43
Psy49t18    GGGGCCG-----AUUUGGA--UUCGACGCCGGUGAU-----GAAACUU-UAGGUGCAUGC--CGAGUU-GGUAACAG-AACUCGUAAAUCCA-------CUGUUGCA-ACUUUCUAUAGUUGCCAAUGACGAAACC------------------------------------------------UACGGGGAAUACGCUCUCGCCGCGUAA-----------------------GCGGUGCUAGCCUUCCUUCUGGUAGCUUCGGCUCCAGCAAUCAUCAGGGGAU------------------GCCUGUAAACCCGAAAUGAUUG---------------------------------------------------------UCAUAUAGAACAGGAUC--GUCGCCUAGUAC-------------GUUGUGGACGAAGCGAC---UAAAACUUA-CACAAC-UC---------GCCCAAAGCACCCUGCCCGUCGGGUCGCUGAGGGU-------UAACUUAAUA--GACACGGCUAAGCA-UGUAG----------------------UACCGACAGCGG------AGUACUGGCGGAC-GGGGGUUCAAAUCCCCC-CGGCUCCACCA Psy49t18
Psy45t15    GGGGCCG-----AUUUGGA--UUCGACGCCGGUGAU-----GAAACUU-UAGGUGCAUGC--CGAGUU-GGUAACAG-AACUCGUAAAUCCA-------CUGUUGCA-ACUUUCUAUAGUUGCCAAUGACGAAAAC---------------------------------------------------UACGGUGCUCAACUAGCUGCGUAA------------------------GCAGCCUAGCCGCACUUCUGGUAGCUUCGGCUCCAGCAAUCAUCAGGGGAU------------------GUCUGUAAACCCAAAAUGAUUG---------------------------------------------------------UCAUAUAGAACAGAAUC--GCCGUGCAGUAC-------------GCUGUGGACGAAUCGGC---UAAAACUUA-CACAGC-UC---------GCCCAAAGCACCCUGCCCGUCGGGUCGCUGAGGGU-------UAACUUAAUA--GACACGGCUACGCA-UGUAG----------------------UACCGACAGCGG------AGUACUGGCGGAC-GGGGGUUCAAAUCCCCC-CGGCUCCACCA Psy45t15
Pfl11t3     GGGGCCG-----UUUAGGA--UUCGACGCCGGUUGC-----GAAACUC-UAGGUGCAUGC--CGACUU-GGUAACAG-AAGUCGUAAAUCCA-------CUGUUGCA-ACUACUUAUAGUUGCCAAUGACGACCAA---------------------------------------------------UACGGUGCUGCUCUCGCUGCUUAA----------------------UUGCAGCUGACAUGCACUCCUGGUACCUUCGGGUCCAGCAAUCAUCAGGGGAU------------------GUCUGUAAACCCAAAAUGAUUG---------------------------------------------------------UCAUAUAGAACAGAAUC--GCCGUGCAGUAC-------------GUUGUGGACGAAGCGGC---UAAAACUUA-CACAAC-UC---------GCCCAAAGCACCCUGCCCGUCGGGUCGCUGAGGGU-------UAACUUAAUA--GACACGGCUACGCA-UGUAG----------------------UACCGACAGCGG------AGUACUGGCGGAC-GGGGGUUCAAAUCCCCC-CGGCUCCACCA Pfl11t3
Pfl13t17    GGGGCCG-----UUUAGGA--UUCGACGCCGGUCGC-----GAAACUU-UAGGUGCAUGC--CGAGUU-GGUAACAG-AACUCGUAAAUCCA-------CUGUUGCA-ACUUCUUAUAGUUGCCAAUGACGAAAAC---------------------------------------------UACGGCCAGGAAUUCGCUCUCGCUGCGUAA------------------GCAGC---CUUAGCCCUGAGCUUCUGGUACCUUCGGGUCCAGCAAUCACCAGGGGAU------------------GUCUGUAAACCCAAAGUGAUUG---------------------------------------------------------UCAUAUAGAACAGAAUC--GCCGUGCAGUAC-------------GUUGUGGACGAAGCGGC---UAAAACUUA-CACAAC-UC---------GCCCAAAGCACCCUGCCCUUCGGGUCGCUGAGGGU-------UAACUUAAUA--GAAACGGCUACGCA-UGUAG----------------------UACCGACAGCGG------AGUACUGGCGGAC-GGGGGUUCAAAUCCCCC-CGGCUCCACCA Pfl13t17
Ppr7t5      GGGGCCG-----UUUAGGA--UUCGACGCCGGUUGC-----GAAACUU-UAGGUGCAUGC--CGAGUU-GGUAACAG-AACUCGUAAAUCCA-------CUGUUGCA-ACUUCCUAUAGUUGCCAAUGACGAAACC------------------------------------------------UACGGGGAUUACGCUCUCGCUGCGUAA------------------GCAGC---CUUAGCCCUUCCCCCCUGGUACCUUCGGGUCCAGCAAUCAUCAGGGGAU------------------GUCUGUAAACCCAAAAUGAUUG---------------------------------------------------------UCAUAUAGAACAGAAUC--GCCGUGCAGUAC-------------GUUGUGGACGAAGCGGC---UAAAACUUA-CACAAC-UC---------GCCCAAAGCACCCUGCCCGUCGGGUCGCUGAGGGU-------UAACUCAAUA--GACACGGCUAAGCA-UGUAG----------------------UACCGACAGCGG------AGUACUGGCGGAC-GGGGGUUCAAAUCCCCC-CGGCUCCACCA Ppr7t5
Pfl1t1      NNNNNNN----NNNNNNNN--NNNNNNGCCGGUUGC-----GAACCUU-UAGGUGCAUGC--CGAGUU-GGUAACAG-AACUCGUAAAUCCA-------CUGUUGCA-ACUUUCUAUAGUUGCCAAUGACGAAACC---------------------------------------------UACGGG---GAAUACGCUCUCGCUGCGUAA------------------GCAGC---CUUAGCCCUUCCCUCCUGGUACCUUCGGGUCCAGCAAUCAUCAGGGGAU------------------GUCUGUAAACCCAAAGUGAUUG---------------------------------------------------------UCAUAUAGAACAGAAUC--GCCGUGCAGUAC-------------GUUGUGGACGAAGCGGC---UAAAACUUA-CACAAC-UC---------GCCCAAAGCACCCUGCCCGUCGGGUCGCUGAGGGU-------UAACUUAAUA--GACACGGCUACGCA-UGUAG----------------------UACCGACAGCAG------AGUACUGGCGGAC-GGGGNNNNNNNNNNNNN-NNNNNNNNNNN Pfl1t1
Pch3t7      NNNNNNN-----NNNNNNN--NNNNNNGCCGGUUGC-----GAAACUU-UAGGUGCAUGC--CGAGUU-GGUAACAG-AACUCGUAAAUCCA-------CUGUUGCA-ACUUCCUAUAGUUGCCAAUGACGAAACC------------------------------------------------UACGGGGAAUACGCUCUCGCUGCGUAA-----------------------GCGGCGCUAGCCUUCCUUCUGGUACCUUCGGGUCCAGCAAUCAUCAGGGGAU------------------GUCUGUAAACCCGAAAUGAUUG---------------------------------------------------------UCAUACAGAACAGAAUC--GCCGUGCAGUAC-------------GUUGUGGACGAAGCGGC---UAAAACUUA-CACAAC-UC---------GCCCAAAGCACCCUGCCCGUCGGGUCGCUGAGGGU-------UAACUCAAUA--GACACGGCUACGCA-UGUAG----------------------UACCGACAGCGG------AGUACUGGCGGAC-GGGGNNNNNNNNNNNNN-NNNNNNNNNNN Pch3t7
Ppu9t5      GGGGCCG-----AUUAGGA--UUCGACGCCGGUAGC-----GAAACUC-UAGGUGCAUGC--CGAGUU-GGUAACAG-AACUCGUAAAUCCA-------CUGUUGCA--ACUUUUAUAGUUGCCAAUGACGAAAAC---------------------------------------------UACGGCGCGGAGUACAAGCUGGCUGCGUAA------------------GCAGUCCUCUUGACCCGUUGCUUCUGGUAGCUUCGGCUCCAGCAAUCACUAGGGGAU------------------GCCUGUAAACCCGAACUGAUUG---------------------------------------------------------UCAUACAGAACAGGAUC--GUCGCGUAGCAC-------------GUUGUGGGCGAAGUGAC---UAAAACUUA-CACAAC-UC---------AUCCAAAGCACCCUGCCCGUCGGGCGGCUGCGGAU-------UAAAUCAGUA--GACACGGCUAAGCA-UGUAG----------------------UACCGACAGCGG------AGUACUGGCGGAC-GGGGGUUCAAAUCCCCC-CGGCUCCACCA Ppu9t5
Ppu2t2      NNNNNNN-----NNNNNNN--NNNNNNGCCGGUAGC-----GAAACUC-UAGGUGCAUGC--CGAGUU-GGUAACAG-AACUCGUAAAUCCA-------CUGUUGCA-ACUUUCUAUAGUUGCCAAUGACGAAACC------------------------------------------UACGGCGAGGAAACCUACGCUCUCGCAGCGUAA------------------G---------UGACCU-UUGCUUCUGGUAGCUUCGGCUCCAGCAAUCACUAGGGGAU------------------GCCUGUAAACCCGAACUGAUUG---------------------------------------------------------UCAUACAGAACAGGAUC--GUCGCGUAGCAC-------------GUUGUGGGCGAAGUGAC---UAAAACUUA-CACAAC-UC---------AUCCAAAGCACCCUGCCCGUCGGGCGGCUGCGGAU-------UAAAUCAGUA--GACACGGCUACGCA-UGUAG----------------------UACCGACAGCGG------AGUACUGGCGGAC-GGGGNNNNNNNNNNNNN-NNNNNNNNNNN Ppu2t2
Aad1t3      GGGGAUG----UUAUUGGC--UUCGACGCUGGUGAU-----GAAGCUCAUAGAUGCAUGC--CGAGAG-CGCAUUUU-CUCUCGUAAAUAA--------AAUUUGCA---UUUUAAUAGUCGCAAACGACGAAACU---------------------------------------------------------UACGCUCUAGCUGCCUAA---------------------------GGGCAGUUU------------------------GUCCGCUUCCUAGAAU-----------------ACUUGUGGUUUAGGAACCCGAC----------------------------------------------------CGUAGCGCACGCACACAAGUCC--GUAUAGAGUCAA--------------GCCUCGGGGCUUUAUAC--CAAACUUA----GAGGAUC------GCAUCUUGU--ACCCU-GUUCGUC-GGGU-CACUGGGUGU----UAAAACAAUA--GACGAUAUCUAAGCA-UGUAG----------------------UAUUCUCGAGUG-----UAGUGCUGGCGGAC-GCGGGUUCAACUCCCGC-CAUCUCCACCA Aad1t3
Aba105t211  NNNNNNN----NNNNNNNN--NNNNNNNNNNNNNNN-----NNNNNNNNNNNNNNNNNNN--NNNNNN-NNNNNNNN-NNNNNNNNNNNNN--------NNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNN---------------------------------------------------------NNNNNNNNNNNNNNNNNN---------------------------NNNNNNNNN------------------------NNNNNNNNNNNNNNNN-----------------NNNNNNNNNNNNNNNNNNNNNN----------------------------------------------------NNNNNNNNNNNNNNNNNNNNNN--NNNNNNNNNNNN--------------NNNNNNNNNNNNNNNNN--NNNNNNNN----NNNNNNN------NNNNNNNNN--NNNNN-NNNNNNN-NNNN-NNNNNNNNNN----NNNNNNNNNN--NNNNNNNNNNNNNNN-NNNNN----------------------NNNNNNNNNNNN-----NNNUGCUGGCGGAC-GCGGGUUCAACUCCCGC-CAUCUCCACCA Aba105t211
Pcr2t1      GGGGAUG-----UUCUGGC--UUCGACGCUGGUGAU-----GAAACUCAAUGAUGCAUGU--CGAGAG-UAUAUGUC-CUCUCGUUAAUCA--------AACAUAUA---UUGUUAUAGUCGCAAACGACGAAAAU---------------------------------------------------------UACGCUCUAGCAGCUUAA---------------------------ACCCUGUUU------------------------ACUUGGUUGCUGAUC------------------AUCUACAGUUGGUCAACUAAGU----------------------------------------------------UGAAGCGUCCGCAUGUAGAAGC--GCCACAAGUGAUU-------------GUCUCAAUUGCUUGGGUU-UAAAAGUA---GAGAA-UC------GUCCUAUCC--AUCCU-GACUGUC-GGAU-CGGUGCGGAC----UAAAACCAAA--GACAGAAACUAAACA-UGUAG----------------------AUUCAUGAGCGU------AAUGCUGGCGGAC-GCGGGUUCAACUCCCGC-CAUCUCCACCA Pcr2t1
Par1t1      GGGGAUG-----UUCUGGC--UUCGACGCUGGUGAU-----GAAACUCAAUGAUGCAUGU--CGAGAG-UAUAUGUC-CUCUCGUUAAUCA--------AACAUAUA---UUGUUAUAGUCGCAAACGACGAAAAU---------------------------------------------------------UACGCUCUAGCAGCUUAA---------------------------ACCCUGUUU------------------------ACUUGGUUGCUGAUC------------------AUCUACAGUUGGUCAACUAAGU----------------------------------------------------UGAAGCGUCCGCAUGUAGAAGC--GCCACAAGUGAUU-------------GUCUCAAUUGCUUGGGUU-UAAAAGUA---GAGAA-UC------AUCCUAUCC--AUCCU-GACUGUC-GGAU-CGGUGCGGAC----UAAAACCAAA--GACAGAAACUAAACA-UGUAG----------------------AUUCAUGAGCGU------AAUGCUGGCGGAC-GCGGGUUCAACUCCCGC-CAUCUCCACCA Par1t1
Pur1t1      NNNNNNN------NNNNNN--NNNNNNGCUGGUGAU-----GAAACUCAAUGAUGCAUGU--CGAGAG-UAUAUGUC-CUCUCGUUAAUCC--------AACAUAUA---UUGUUAUAGUCGCAAACGACGAAAAU---------------------------------------------------------UACGCUCUAGCAGCUUAA---------------------------ACCCUGUUU------------------------ACUUGGUUGCUGAUC------------------ACCUACAGUUGGUCAACUAAGU----------------------------------------------------UGAAGCGUCCGCAUGUAGGAUC--GCCACAAGGGAUU-------------GUCUCAAUCCUUUGGGUU-CAAAAGUA---GAGAC-UC------GGCUAAUCC--AUCCU-GACUGUC-GGAU-CGGUGCAGAC----UAAAAUUAAA--GACAGAAACUAAACA-UGUAG----------------------AUUCAUGAGCGU------AAUGCUGGCGGAC-GCGGNNNNNNNNNNNNN-NNNNNNNNNNN Pur1t1
Oceanospirillales
Csa2t1      GGGGGCG-----ACAUGGC--UUCGACGCCGGUGAC-----AAUCCCU-GAGGUGCAUGC--CGAGAG-CGUAACGU-AUCUCGUAAAUCCA-------ACGUUACG---AUUAAAUAGUCGCAAACGACGACAAC------------------------------------------------UACGCUCAGGGCGCGCUGGCAGCGUAA--------------------------CAACUGCUAG------------------------CUUCUAGUCCGGCCCGGAGGUGAUGUG------CCCAUUCAUCACCGAUGGGAUACGAGC----------------------------------------------------UCAGACU-GAUGGGAUC--GCGGUUGGCCCUG-------------UCCUCGUGUCAGCCGC---UAAAACUUA--GAGGAAUC--------GCGUCGCUGGAUCCUGCCCGUCGGAGCCAGGGACGU-------UAAAUCAGAA--GACGGACCUAAGCA-UGUAG----------------------AGCCGAUGGGUG------AGUGCCGGCGGAC-GGGGGUUCAAUUCCCCC-CGCCUCCACCA Csa2t1
Alteromonadales
Mhy2t5      NNNNNNN----NNNNNNNN--NNNNNNGCCGGUGAC-----GAACCCU-UGGGUGCAUGC--CGAGAU-GGCAGCGA-AUCUCGUAAAUCCA-------AAGCUGCA---ACGUAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUGGCGGCGUAA------------------------GCCGUU-CCAGU------------------------CGUCCUGGCUGAGGC------------------GCCUAUAACUCAGUAGCAACAUCCCAGGACG-----------------------------------------------UCAUCGCUUAUAGGCU----GCUCCGUUCACCAGA-----------GCUCACUGGUGUUCGGC--UAAGAUUAAA--GAGC-UC-------GCCUCU-UGCACCCUGACCUUCGGGUCGCUUGAGGU-------UAAAUCAAUA--GAAGGACACUAAGCA-UGUAG----------------------ACCUCAAGGCCU------AGUGCUGGCGGAC-GCGGNNNNNNNNNNNNN-NNNNNNNNNNN Mhy2t5
Maq1t1      GGGGACG-----ACUUGGC--UUCGACGCCGGUGAC-----GAACCCU-UGGGUGCAUGC--CGAGAU-GGCAGCGA-AUCUCGUAAAUCCA-------AAGCUGCA---ACGUAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUGGCGGCGUAA------------------------GCCGUU-CCAGU------------------------CGUCCUGGCUGAGGC------------------GCCUAUAACUCAGUAGCAACAUCCCAGGACG-----------------------------------------------UCAUCGCUUAUAGGCU----GCUCCGUUCACCAGA-----------GCUCACUGGUGUUCGGC--UAAGAUUAAA--GAGC-UC-------GCCUCU-CGCACCCUGACCUUCGGGUCGCUUGAGGU-------UAAAUCAAUA--GAAGGACACUAAGCA-UGUAG----------------------ACCUCAAGGCCU------AGUGCUGGCGGAC-GCGGGUUCAAUUCCCGC-CGUCUCCACCA Maq1t1
Sde1t1      GGGGGCG-----AUUAGGA--UUCGACGCCGGUAAC-----AAAACCC-GAAGUGCAUGU--CGUGAG-GGUAGCCA-AUCACGUAAAUCCA-------AAGCUGCA---AAUUAUCAGUUGCCAAUGAUGACAAC---------------------------------------------------UACGGUGCUCAACUAGCUGCGUAA-----------------------GUAGCUUUUUGUUACACCAUCUAGCGGUACGCCGCUAGCGGUUUUUAACA---------------------AGGUGCCAGUACCGC-------------------------------------------------------------GUUAACGACUGUCACUUAGAACUGGAUCGCAGUGAAGCCUG------CCUGGGGUGGAUCAGCU--AAACUUUU---ACAGGAUC-------GCGCUUU-UCGUCCCGCCCGCUGGGCUGUAAAGCGU-------UAAAUCAAUA---AGCGGUUCUAAGCA-UGUAG----------------------AGCUGACGGCGG------AGUACUGACGGAC-GGGGGUUCAAAUCCCCC-CGCCUCCACCA Sde1t1
Cps42t1     GGGGCGG----AUCUAGGA--UUCGACAAGAUUCAU-----GAAACUC-AAGGUGCAUGC--CCAGG--GGCGGUUU-GCCUGGUAAA-----------AAGCCGCA---AAACUAUAAUUGCUAACGACGAUACG---------------------------------------------------------UUCGCACUAGCCGCUUAG---------------------------GCUAG----------------------------CCAUCGCCUUGAAAUCUC--------------UCCUAUUGGUUAGAGG---AU--CGAUGG--------------------------------------------------UCACCCCA-AAUAGGAUA--GCGAGGGAAGCAC------------GCUUGAGGCU-GAACCGC--GAAAUAGUA-UCAAGC-UC-------ACCAUGACGAAGCCUGUCGCUUGGCGUCUAAUUGGU-------UAAAUAAAU----GAG-CGACUAAGCA-UGUAG----------------------UACCGAGAACGU------AGGCUUUUUGGAC-GGGGGUUCGAUUCCCCC-CCGCUCCACCA Cps42t1
Pha2t3      NNNNNNN----NNNNNNNN--NNNNNNGGAAUUCAA-----GAAGCCC-GAGGUGCAUGU--CGAGG--UGCGGUUU-GCCUCGUAAAA----------AAGCCGCA-AUUUAAAGUAAUCGCAAACGACGAUAAC---------------------------------------------------------UACUCUCUAGCAGCUUAG-----------------------GCUGGCUAG----------------------------CGCUCCUUCCAUGUAU----------------UCUUGUGGACU--GGA--UUUU-GGAGUG--------------------------------------------------UCACCCUAACACCUGAUC--GCGACGGAAACCCU------------GGCCGGGGUUGAAGCGU--UAAAACUAAG-CGGCC-UC-------GCCUUUAUCUACCGUGUUUGUCCGGGAUUUAAAGGU-------UAA-UUAAAU---GACAAUACUAAACA-UGUAG----------------------UACCGACGGUCG------AGGCUUUUCGGAC-GGGGNNNNNNNNNNNNN-NNNNNNNNNNN Pha2t3
Pha3t1      GGGGCUG-----AUUAGGA--UUCGACGGAAUUCAA-----GAAGCCC-AAGGUGCAUGU--CGAGG--UGCGGUUU-GCCUCGUUAAA----------CAGCCGCA-ACCUAAAGUAAUCGCAAACGACGAUAAC---------------------------------------------------------UACUCUCUAGCGGCUUAG-----------------------GCCAGCUAG----------------------------CGCUCCUUCUAUGUAU----------------UCUUGUGGACU--AGA--UUUU-GGAGUG--------------------------------------------------UCACCCUAACACCUGAUC--GCGAUGGAAACCCU------------GGCCGGGGUUGAAGCGU--UAAAACUAAG-CGGCC-UC-------GCCUUUAUUUACCGUGUUUGUCCGGGACUUAAAGGU-------UAAUUAAAU----GACAAUACUAAGCA-UGUAG----------------------UACCGACGGUCG------AGGCUUUUCGGAC-GGGGGUUCAAAUCCCCC-CAGCUCCACCA Pha3t1
Pat4t1      GGGGCUG----AUUUUGGA--UUCGACAAGAUUCUU-----GAGGCUU-UAGGUGCAUGC--AGAGG--AGCGGUUU-GCCUCUUAAA-----------AAGCCGCA---UUUAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUCUAGCCGCUUAA---------------------------UAACCGGCUAAGC------------------------CCUUCCACUCAUACUCU---------------UUCUGCUAGUA--GAG--GUUC-GGAAGG--------------------------------------------------UCAUCCC--AGCAGAAUA--GCGAGGGA-ACCUU------------GUCUAAGGGUGAACCGC--GAAAUAGUAU-UAGGC-CC-------GCUAUGAGAAAUCCUGUCUGCCGGAGUUCGAAAUAGU------UAAAUAAAA----GAC-AGAAUAAGCA-UGUAG----------------------UACCGACGGUUA------ACGUUUUUUGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Pat4t1
Son1t3      GGGGGCG----AUUCUGGA--UUCGACAGGAUUCAC-----GAAACCC-UGGGAGCAUGC--CGAGG--GGCGGUUG-GCCUCGU-AAA----------AAGCCGCA---AAGUUAUAGUUGCAAACGACGAUAAC---------------------------------------------------------UACGCUCUAGCCGCUUAA-----------------------UGCCGCUAG----------------------------CCAUCUACCACACGCUUU--------------GCACAUGGGCAGUGGA--UUU---GAUGG--------------------------------------------------UCAUCUCACAUCGUGCUA--GCGAGGGAACCCU-------------GUCUGGGGGUGAACCGC--GAAACAGUA-CCGGAC-UC-------ACCGUGUGGGAUCCUGUCUUUCGGAGUUCAAACGGU-------UAAACAAUA----GAA-AGACUAAGCA-UGUAG----------------------CGCCUUGGAUGU------AGGUUUUCUGGAC-GCGGGUUCAAGUCCCGC-CGCCUCCACCA Son1t3
Spu3t1      GGGGGCG----AUUCUGGA--UUCGACAGGAUUCAC-----GAAACCC-UGGGAGCAUGC--CGAGG--GGCGGUUG-GCCUCGU-AAA----------AAGCCGCA---CAGUUAUAGUUGCAAACGACGAUAAC---------------------------------------------------------UACGCUCUAGCAGCUUAG-----------------------GCUAGCUAG----------------------------CCAUCUGACACAGGUCUC--------------UCAAAUGGGCGGUGUA----UACAGAUGG--------------------------------------------------UCAUCUUACAU-UUGAUA--GCGAGGGAACUCC-------------GUCCGGGGGUGAACCGC--GAAAUAGUA-CCGGAC-UC-------GCCCGAUGAAAUCCUGUCUUUCGGAGUUUAUUCGGGU------UAAUUAAAA----GAG-AGACUAAGCA-UGUAG----------------------UGCCUUGGAUGU------AGGUGUUCUGGAC-GCGGGUUCAAGUCCCGC-CGCCUCCACCA Spu3t1
Slo1t1      GGGGGCG----AUUCUGGA--UUCGACAAGAUUCAC-----GAAACCC-UAGGAGCAUGC--CGAGG--GGCGGUUG-GCCUCGU-AAA----------AAGCCGCA---CAGUUAUAGUUGCAAACGACGAUAAC---------------------------------------------------------UACGCUCUAGCAGCUUAG-----------------------GCUAGCUAG----------------------------CCAUCUUGCUCACGUUUC--------------UCAAAUGGGCAGAGUA----UUAAGAUGG-------------------------------------------------UCACCUUUACAU-UUGAUA--GCGAGGGAACCAU-------------GUUCAGGGGUGAACCGC--GAAACAGUA-CUGAAC-UC-------GCCAAUAACAAUCCUGUCUUUCGGAGUGUUGUUGGU-------UAACCAAUA----GAA-AGACUAAGCA-UGUAG----------------------CGCCGAGGAUGU------AGGCUUUUUGGAC-GCGGGUUCAAGUCCCGC-CGCCUCCACCA Slo1t1
Sde2t1      GGGGGCG----AUUCUGGA--UUCGACAGGAUUCAC-----GAAACCC-AAGGAGCAUGU--CGAGG--GGCGGUUG-GCCUCGU-AAA----------AAGCCGCA---CCGUUAUAGUUGCAAACGACUCUAAC---------------------------------------------------------UACUCUCUAGCAGCUUAG-----------------------GCUAGCUAG----------------------------CCAUCUGACCCAGGUUUC--------------UCAAAUGGGCGGGGUA----UACAGAUGG--------------------------------------------------UCAUAUAACAU-UUGAUA--GCGAGGGAACUCC-------------GUCCGGGGGUGAACCGC--GAAACAGUA-CCGGAC-UC-------GCCAUGUAGCAUCCUGUCUUUCGGAGACUGCCUGGU-------UAACUAAAA----GAG-AGACUAAACA-UGUAG----------------------CGCCGAGGAUGU------AGGCUUUCUGGAC-GCGGGUUCAAGUCCCGC-CGCCUCCACCA Sde2t1
Sfr1t1      GGGGGCG----AUUCUGGA--UUCGACAGGAUUCAC-----GAAACCC-AAGGAGCAUGU--CGAGG--GGCGGUUG-GCCUCGU-AAA----------AAGCCGCA---CCGUUAUAGUUGCAAACGACUCUAAC---------------------------------------------------------UACUCUCUAGCAGCUUAG-----------------------GCUAGCUAG----------------------------CCAUCAACCACACGUUUC--------------GCACGUGGACAGUGGA----UUCUGAUGG--------------------------------------------------UCAUAUUACAGUGUGCUA--GCGAGGGAACUCC-------------GUCCGGGGGUGAACCGC--GAAACAGUA-CCGGAC-UC-------ACCAAGUAGCAUCCUGUCUUUCGGAGACUGCUUGGU-------UAAAUAAAA----GAG-AGACUAAACA-UGUAG----------------------UGCCGAGGAUGU------AGGCUUUCUGGAC-GCGGGUUCAAGUCCCGC-CGCCUCCACCA Sfr1t1
Sam1t1      GGGGGCG----AUUCUGGA--UUCGACGGGAUUCGC-----GAAACUC-CGGGAGCAUGC--CGAGG--GGCGGUUG-GCCUCGU-AAA----------AAGCCGCA---AAGUUAUAGUUGCAAACGACGAUAAC---------------------------------------------------------UACGCUCUGGCUGCUUAA----------------------UUAGCGCCAG----------------------------CCAUCUACCACAGGUCUC--------------GCACAUGGGCAGUGGA-----UUUGAUGG--------------------------------------------------UCACCUUACAUCGUGCUA--GCGAGGGAACCUU-------------GUCUGGGGGUGAACCGC--GAAACAGUU-CCAGGC-UC-------ACCGUUAGAAAUCCUGUCUUUCGGAGUUCGAGCGGU-------UAAAUAAAA----GAG-AGACUAAGCA-UGUAG----------------------CGCCUUGAGCGU------AGGUUUUUCGGAC-GCGGGUUCAAGUCCCGC-CGCCUCCACCA Sam1t1
Sba3t7      GGGGGCG----AUUCUGGA--UUCGACAGGAUUCAC-----GAAACCC-UGGGAGCAUGC--CGAGG--GGCGGUUG-GCCUCGU-AAA----------AAGCCGCA---CCGUUAUAGUUGCAAACGACUCUAAC---------------------------------------------------------UACUCUCUAGCAGCUUAG-----------------------GCUAGCUAG----------------------------CCAUCUGACACAGGUCUC--------------UCAAAUGGGCAGUGUA----UACAGAUGG--------------------------------------------------UCAUCCUACAU-UUGAUA--GCGAGGGAACUCC-------------GUCCGGGGGUGAACCGC--GAAAUAGUA-CCGGAC-UC-------GCCCGAUGAAAUCCUGUCUUUCGGAGUUUAUUCGGGU------UAAUUAAAA----GAG-AGACUAAGCA-UGUAG----------------------UGCCUUGGAUGU------AGGUGUUCUGGAC-GCGGGUUCAAGUCCCGC-CGCCUCCACCA Sba3t7
San1t3      GGGGGCG----AUUCUGGA--UUCGACAGGAUUCAC-----GAAACCC-UGGGAGCAUGC--CGAGG--GGCGGUUG-GCCUCGU-UAA----------AAGCCGCA---AAGUUAUAGUUGCAAACGACGAUAAC---------------------------------------------------------UACGCUCUAGCCGCUUAA-----------------------UGCCGCUAG----------------------------CCAUCUACCACACGUUUC--------------GCACAUGGGCAGUGGA--UUU---GAUGG--------------------------------------------------UCAUCUCACAUCGUGCUA--GCGAGGGAACCCU-------------GUCCGGGGGUGAACCGC--GAAACAGUA-CCGGAC-UC-------ACCGUGUGGGAUCCUGUCUUUCGGAGUUCAAACGGU-------UAAACAAUA----GAA-AGACUAAGCA-UGUAG----------------------CGCCUUGGAUGU------AGGUUUUCUGGAC-GCGGGUUCAAGUCCCGC-CGCCUCCACCA San1t3
Spu3t1      NNNNNNN----NNNNNNNN--NNNNACAGGAUUCAC-----GAAACCC-UGGGAGCAUGC--CGAGG--GGCGGUUG-GCCUCGU-AAA----------AAGCCGCA---CAGUUAUAGUUGCAAACGACGAUAAC---------------------------------------------------------UACGCUCUAGCAGCUUAG-----------------------GCUAGCUAG----------------------------CCAUCUGACACAGGUCUC--------------UCAAAUGGGCGGUGUA----UACAGAUGG--------------------------------------------------UCA-UCUUACAUUUGAUA--GCGAGGGAACUCC-------------GUCCGGGGGUGAACCGC--GAAAUAG-UACCGGAC-UC-------GCCCGAUGAAAUCCUGUCUUUCGGAGUUUAUUCGGGU------UAAUUAAAA----GAG-AGACUAAGCA-UGUAG----------------------UGCCUUGGAUGU------AGGUGUUCUGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN Spu3t1
Ilo2t3      GGGGCUG-----AUCUGGA--UUCGACGGGAUACAC-----GAAACCC-AAGGUGCAUGC--CGAGG--UGAGGCAG-GCCUCGUAAAA-----------AGCCUCA---ACCUAAUAGUUGCAAACGACGACAAC---------------------------------------------------------UACGCUCUAGCGGCUUAA---------------------UAACCCGCUA--AGC------------------------CCAUCCCCCGGCGCUUU----------------GUCUGCGAGACCGGA----CCAGGAUGG-------------------------------------------------CUCAAACUAAUGUAGACUC--GCGU-GGAGGCUUU------------GUCCGGAGCUGAAGCGU--UAAAACCAA-UCGGAC-UC------GUCAGUUGUGAAGCCUGUCAGUCGGC-GUCACACUGAU------UAACUAAAA----GAC-UGACUAAGCA-UGUAG----------------------GACCGAGGAUGU------AGGUAUUGCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Ilo2t3
Vibrionales
Pph2t1      NNNNNNN----NNNNNNNN--NNNNNNAGGAUCACG-----AAGGCUU-GUGGAGCAUGU--CGAGG--UGCGGUUU-GCCUCGUUAAA----------CAGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUAGCAGCUUAA---------------------UACCCUGCUAAGAGCG-----------------------CUCCUGCCCUAGCUUCC----------------GCUUGUAAGACGGGGAAUAA--CAGGGG-------------------------------------------------UUCAAACCCAAACGAGAUA--GCGAGGGAUUCUUUGA---------CUAGAGAGA-UGAACCGC--GAAAUAGAA-UUCUGG-UA------UGUAUUAGCAUAGCGUGUCAAUUCGCAGUGACGAUACG------AGAA-UAAA----GAU-UGACUAAACA-UGUAG----------------------CGCCAUCUGUUA-----GACUGAUUUUGGAC-GCGGNNNNNNNNNNNNN-NNNNNNNNNNN Pph2t1
Ppr4t4      GGGGCUG----AUUCAGGA--UUCGACAGGAUCAAG-----AAGGCUU-GUGGAGCAUGC--CGUGG--GGCGGUUG-GCCACGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UUCGCACUAGCAGCUUAA---------------------UAACCUGCUAG-CGCA-----------------------CUUCUACCCUAGCUUCC----------------GCUUGUAAGACGGGGAAUCA--UAGAAG-------------------------------------------------UUCAAACCCAAACGAGAUA--GCGAGGGAACCUUUGA---------CUAGAGAGG-UGAACCGC--GAAAUAGAA-UUCUGG-UA------UGUAUUUACAUGGCGUGUCUGUUCGCAGUGUACUUACG------AGAA-UAAA----GAU-AGACUAAGCA-UGUAG----------------------CGCCUAUGGUUG-----GAUUGCUCUUGGAC-GCGGGUUCAAAUCCCGC-CAGCUCCACCA Ppr4t4
Vfi1t1      GGGGCUG----AUUCAGGA--UUCGACGGGAAUUUU-----GAAACCC-GAGGAGCAUGU--CGUGG--GGCGGUUG-GCCACGUAAA-----------AAGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUAGCAGCUUAA---------------------UAACCUGCUGAGAGC------------------------UCUCCUGCCCUAGCUUCU---------------GCUUGUAAGACGGGGAAUAA-CAGGGGA--------------------------------------------------UCAAACCCAAACGAGCUA--GAAC-GGAUUCUCCC----------GCCUGAGAGAUGAACUUC--GAAUUAUAAUUCAGGA-UA-------GCCAUAAGAUAGCGUGUCGGUUCGCAGUUUUACGGU-------GAAAUCAAA----GAU-CGACUAAACA-UGUAG----------------------CGCCAACGGUGA------ACGAUUUUCGGAC-GGGGGUUCAAAUCCCCC-CAGCUCCACCA Vfi1t1
Vch1t201    GGGGCUG----AUUCAGGA--UUCGACGGGAAUUUU-----GCAGUCU-GAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGUUAAC----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUAGCAGCUUAA---------------------UACCCUGCUCAGAGC------------------------CCUUCCUCCCUAGCUUCC---------------GCUUGUAAGACGGGGAAAUC-AGGAAGG--------------------------------------------------UCAAACCAAAUCAAGCUG--GCGU-GGAUUCCCCC----------ACCUGAGGGAUGAAGCGC--GAGAUCUAAUUCAGGU-UA-------GCCAUUCGUUAGCGUGUCGGUUCGCAGGC-GGUGGU-------GAAAUUAAA----GAU-CGACUAAGCA-UGUAG----------------------UACCAAAGAUGA------AUGGUUUUCGGAC-GGGGGUUCAACUCCCCC-CAGCUCCACCA Vch1t201
Vex1t4      GGGGCUG----AUUUAGGA--UUCGACGGGAAUUCA-----GAAGUCU-GAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGUUAAC----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUAGCAGCUUAA---------------------UAACCUGCUCAGAGC------------------------UCUCUCGCCCUAGCUUCC---------------GCACGUAAGACGGGGAAUAA-CGAGGGA--------------------------------------------------UCAAACCCAAACGCGCUA--GCCC-GGAUUCUCCC----------GCCUGAGAGAUGAACGGC--GAAUUUUAAUUCAGGC-UA-------GUCAUUCAUUAGCGUGUCGGUUCGCAGGUGGGUGGC-------GAAAUUAAA----GAU-CGACUAAGCA-UGUAG----------------------UACCAAUGAUGA------ACGGUUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Vex1t4
Vpa12t11    GGGGCUG----AUUUAGGA--UUCGACGGGAAUUCA-----GAAGUCU-GAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGUUAAC----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUAGCAGCUUAA---------------------UACCCUGCUCAGAGC------------------------UCUCUCGCCCUAGCUUCC---------------GCACGUAAGACGGGGAAUAA-CGAGAGA--------------------------------------------------UCAAACCCAAACGCGCUA--GCCC-GGAUUCUCCC----------GCCUGAGAGAUGAACGGC--GAAUUAUAAUUCAGGA-UA-------GUCAUUCAUUAGCGUGUCGGUUCGCAGGUGGAUGGU-------GAAUUUAAA----GAU-CGACUAAGCA-UGUAG----------------------UACCAAUGAUGA------AAGGUUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Vpa12t11
Vvu1t3      GGGGCUG----AUUUAGGA--UUCGACGGGAAUUUU-----GCAGUCU-GAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGUUAAC----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUAGCAGCUUAA---------------------UAAACUGCUCAGAGC------------------------CCUCUCGCCCUAGCUUCC---------------GCUUGUAAGACGGGGAAUCA-CGAGGGG--------------------------------------------------UCAAACCAAAUCAAGCUG--GCGU-GGAUUCCCCC----------ACCUGAGGGAUGAAGCGU--AAGAUAUAAUUCAGGU-UA-------GCUAUUCAUUCGCGUGUCGGUUCGCAGGU-GGUAGU-------GAAAUUAAA----GAU-CGACUAAGCA-UGUAG----------------------UACCAAUGAUGA------AUGGUUUUCGGAC-GGGGGUUCAAAUCCCCC-CAGCUCCACCA Vvu1t3
Aeromonadales
Ahy1t3      GGGGCUG----AUUCUGGA--UUCGACAAGAUUCAC-----GAAACCC-AAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGCUAAU----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUGGCAGCUUAA---------------------UAACCUGCGCAGAGC------------------------CCUUCUACCCUAGCAU----------------GCCUGUGUCCUAGGGAA----UCGGAAGG--------------------------------------------------UCA-UCCUUCACAGGAUC--GUGUGGAAGUCCU-------------GCUCGGGGCGGAAGCAU--UAAAACC-AAUCGAGC-UA-------GUCAAUUCGUGGCGUGUCUCUCCGCAGCGGGUUGGC-------GAAUGUAAA----GAG-UGACUAAGCA-UGUAG----------------------UGCCAAGGAUGU------AGUAAUUUUGGAC-GGGGGUUCAAAUCCCCC-CAGCUCCACCA Ahy1t3
Ahy1t5      GGGGCUG----AUUCUGGA--UUCGACAAGAUUCAC-----GAAACCC-AAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGUUAAU----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUCGCAGCUUAA---------------------UAACCUGCGCUGAGC------------------------CCUUCUACCCUAGCUU----------------GCCUGUGUCCUAGGGAA----UCGGAAGG--------------------------------------------------UCA-UCCUUCACAGGAUC--GUGUGGAAGUCCU-------------GCUCGGGGCGGAAGCAU--UAAAACC-AAUCGAGC-UA-------GUCAAUUCGUGGCGUGUCUCUCCGCAGCGGGUUGGC-------GAAUGUAAA----GAG-UGACUAAGCA-UGUAG----------------------UGCCAAGGAUGU------AGUAAUUUUGGAC-GGGGGUUCAAAUCCCCC-CAGCUCCACCA Ahy1t5
Asa1t9      NNNNNNN----NNNNNNNN--NNNNNNAAGAUUCAC-----GAAACCC-AAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGUUAAC----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUAGCAGCUUAA---------------------UAACCUGCAUAGAGC------------------------CCUUCUACCCUAGCUU----------------GCCUGUGUCCUAGGGAA----UCGGAAGG--------------------------------------------------UCA-UCCUUCACAGGAUC--GUGUGGAAGUCCU-------------GCUCGGGGCGGAAGCAU--UAAAACC-AAUCGAGC-UA-------GUCAAUUCGUGGCGUGUCUCUCCGCAGCGGGUUGGC-------GAAUGUAAA----GAG-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGUAAUUUUGGAC-GGGGNNNNNNNNNNNNN-NNNNNNNNNNN Asa1t9
B1t30       NNNNNNN----NNNNNNNN--NNNNACAAGAUUCAC-----GAAACCC-AAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGUUAAC----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUCGCAGCUUAA---------------------UAACCUGCGCUGAGC------------------------CCUUCUACCCUAGCUU----------------GCCUGUGUCCUAGGGAA----UCGGAAGG--------------------------------------------------UCA-UCCUUCACAGGAUC--GUGUGGAAGUCCU-------------GCUCGGGGCGGAAGCAU--UAAAACC-AAUCGAGC-UA-------GUCAAUUCGUGGCGUGUCUCUCCGCAGCGGGUUGGC-------GAAUGUAAA----GAG-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGUAAUUUUGGAC-GGGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t30
B1t14       NNNNNNN----NNNNNNNN--NNNNACAAGAUUCAC-----GAAACCC-AAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGUUAAC----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUCGCAGCUUAA---------------------UAACCUGCGCUGAGC------------------------CCUUCUACCCUAGCUU----------------GCCUGUGUCCUAGGGAA----UCGGAAGG--------------------------------------------------UCA-UCCUUCACAGGAUC--GUGUGGAAGUCCU-------------GCUCGGGGCGGAAGCAU--UAAAACC-AAUCGAGC-UA-------GUCAAUUCGUGGCGUGUCUCUCCGCAGCGGGUUGGC-------GAAUGUAAA----GAG-UGACUACGCA-UGUAG----------------------UACCGAGGAUGU------AGUAAUUUUGGAC-GGGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t14
B1t9        NNNNNNN----NNNNNNNN--NNNNACAAGAUUCAC-----GAAACCC-AAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGUUAAC----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUCGCAGCUUAA---------------------UAACCUGCGCUGAGC------------------------CCUUCUACCCUAGCUU----------------GCCUGUGUCCUAGGGAA----UCGGAAGG--------------------------------------------------UCA-UCCUUCACAGGAUC--GUGUGGAAGUCCU-------------GCUCGGGGCGGAAGCAU--UAAAACC-AAUCGAGC-UA-------GUCAAUGCGUGGCGUGUCUCUCCGCAGCGUGUUGGC-------GAAUGUAAA----GAG-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGUAAUUUUGGAC-GGGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t9
B1t19       NNNNNNN----NNNNNNNN--NNNNACAAGAUUCAC-----GAAACCC-AAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGUUAAC----------AAACCGCA---AAAAAGUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUCGCAGUUUAA---------------------UAACCUGCGCUGAGC------------------------CCUUCUACCCUAGCUU----------------GCCUGUGUCCUAGGGAA----UCGGAAGG--------------------------------------------------UCA-UCCUUCACAGGAUC--GUGUGGAAGUCCU-------------GCUCGGGGCGGAAGCAU--UAAAACC-AAUCGAGC-UA-------GUCAAUGCGUGGCGUGUCUCUCCGCAGCGUGUUGGC-------GAAUGUAAA----GAG-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGUAAUUUUGGAC-GGGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t19
B1t5        NNNNNNN----NNNNNNNN--NNNNGCAAGAUUCAC-----GAAA-CC-AAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGUUAAC----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUCGCAGCUUAA---------------------UAACCUGCGCUGAGC------------------------CCUUCUCCCCUAGCUU----------------GCCUGUGUCCUAGGGAA----UUGGAAGG--------------------------------------------------UCA-UCCUUCACAGGAUC--GUGUGGAAGUCCU-------------GCUCGGGGCGGAAGCAU--UAAAACC-AAUCGAGC-UA-------GU-AAUGCGUGGCGUGUCUCUCCGCAGCGUGUUGGC-------GAAUGUAAA----GAG-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGUAAUUUUGGAC-GGGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t5
B1t32       NNNNNNN----NNNNNNNN--NNNNACAAGAUUCAC-----GAAACCC-AAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGUUAAC----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUCGCAGCUUAA---------------------UAACCUGCGCUGAGC------------------------CCUUCUCCCCCAGCUU----------------GCCUGUGUCCUAGGGAA----UUGGAAGG--------------------------------------------------UCA-UCCUUCACAGGAUC--GUGUGGAAGUCCU-------------GCUCGGGGCGGAAGCAU--UAAAACC-AUUCGAGC-UA-------GUCAAUGCGUGGCGUGUCUCUCCGCAGCGUGUUGGC-------GAAUGUAAA----GAG-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGUAAUUUUGGAC-GGGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t32
B1t26       NNNNNNN----NNNNNNNN--NNNNACGGGACACUC-----GAAACCC-AAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGUUAAU----------AAACCGCA----AAAAAUAGUCGCAAACGACGAAACC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUCGGAGC------------------------CCUUCUACCCUAGCUU----------------GCCUAUGUCCUAGGGGA----UUGGAAGG--------------------------------------------------UCA-UCUUUCAUAGGAUC--GCGUGGAAACCUU-------------GUCUGGGGUGGAAGCGU--UAAAACU-AAUCAGAC-UA-------GUUAUUCAGUGGCGUGUCGGUCCGCAGCUGGAUGGU-------GAAUGUAAA----GAUUCGACUAAGCA-UGUAG----------------------UACUGAGGAUGU------AGGUUUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t26
B1t10       NNNNNNN----NNNNNNNN--NNNNACGGGACACUC-----GAAACCC-AAGGUGCAUGC--CGAGG--U-CGGUAG-GCCUCGUUAAU----------AAACCGCA----AAAGAUAGCCGCAAACGACGAAACC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUCGGAGC------------------------CCUUCUACCCUAGCUU----------------GCCUAUGUCCUAGGGGA----UUGGAAGG--------------------------------------------------UCA-UCUUUCAUAGGAUC--GCGUGGAAACCUU-------------GUCUGGGGUGGAAGCGU--UAAAACU-AAUCAGAC-UA-------GUUAUUCAGUGGCGUGUCGGUCCGCAGCUGGAUGGU-------GAAUGUAAA----GAUUCGACUAAGCA-UGUAG----------------------UACUGAGGAUGU------AGGUUUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t10
B1t17       NNNNNNN----NNNNNNNN--NNNNACGGGACACUC-----GAAACCC-AAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGUUAAU----------AAACCGCA----AAAAAUAGUCGCAAACGACGAAACC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUCGGAGC------------------------CCUUCUACCCUAGCUU----------------GCCUAUGUCCUAGGGGA----UUGGAAGG--------------------------------------------------UCA-UCUUUCAUAGGAUC--GCGUGGAAGCCUU-------------GUCUGGGGUGGAAGCGU--UAAAACU-AAUCAGAC-UA-------GUUAUUCAGUGGCGUGUCGGUCCGCAGCUGGGUGGC-------GAAUGUAAA----GAUUCGACUAAGCA-UGUAG----------------------UACUGAGGAUGU------AGGUUUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t17
B1t36       NNNNNNN----NNNNNNNN--NNNNACGGUACACUA-----GAAAACC-AAGGUGCAUAC--CGAGG--UGCGGUAG-CCUUCGUUAAU----------AAACCGCA----AAAGAUAGUCGCAA-CGACGAAACG---------------------------------------------------------CACGCUUUAGCAGCUUAA---------------------UAUGCUGCUAGGACU------------------------CCUUCUNNACUAGCUU----------------GCUUAUGUCCUAGGGGA----UUGAAAGG--------------------------------------------------UCA-UCUUUCAUAGAGAC--GCGUGGAAGCCCU-------------GUCUGGGGUGGAAGCGU--CAAAACU-AAUCAGGC-AA-------GUUAUGCAAUGGCGUGGCGGACCGGAGCUGGGUGGC-------GAAUGGAAA----GAUUCGACUAAGCA-UGUAG----------------------UACUGAGGAUGU------AGUAUUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t36
Enterobacteriales
Wgl1t1      GGGGCUG----AUUAUGGA--UUCGACGAAAUAAAC-----AAAACUA-AAGAUGCAUGU--CGAGC--AGAGGUGG-A-CUCGUAAA------------ACCUCAA----AUUGAUAAUUGCAAAACAUAAGUAC------------------------------------------------AACGAGCCUGCUCUAUUAGCAGCUUAA------------------------UUAGAAUAAAAUCUUAGGCUC---------------CUUCUUAGAUAUAUU-----------------AUCUCUAGAUGUAUCA-----AUAGAAG---------------------------------------------------UCAAA---AUUAGAGAUC--GCGA-UAUGAACGG----------GCUUGUACGUUCC-UACGC--UAAAAUAA-UACAAGA-UA-------AUUUUUAGUUCACACUUCUUUCUGUAGAACUAAAAAU--------AUUUAA-----GAA-AGAAUAAACA-UGUAG----------------------UAUCAAUAGAAU------UGAAGUUUCGGAC-GCGGGUUCAAAUCCCGC-CAGCUCCAuau Wgl1t1
Bfl1t1      GGGGCUG----AUUUAGGU--UUCGACUGAAUGUCU-----UUGUGUUUGCAGUGCAUGU--CGAGG--GGAGAUAG-GCCUCGUAAAA---------AAAUCUCAA-----AAAAUAAUUGCAAAAAAUAAAUAU------------------------------------------------AAUGAACCUGUUGCAUUAGCAGCUUAA----------------------UUGGGUUAAUAACCUAAAGGUUC---------------CCUCUUAAUUUUUUUGUU--------------ACUCUUAACAAGAAAAUCAUUAUCUCAUAAGAGG---------------------------------------------UCUAUA--AAUAAGAGCG--CUCA-UUAUAAAGU-----------GCCUAACUCUAUAAUGAUAAGAAUAAAAAUUAGAGC-UA------AUUGAUUAAUUGACAUGAUCUUAAGUCAUUUUUCAAU---------AAAAUA----UUAAAGAUCUAAACA-UGUAG---------------------UAUCUGGA-AAAUAU----AAGAAUUCUGGAC-GCGGGUUCGAAUCCCGC-CAGCUCCAuuu Bfl1t1
Bpe2t1      GGGGCUG----AUUUUGGA--UUCGACGGAGUAUCU-----UGUUAUUUAAAGUGCAUGC--CGAGG--UGAGGCAG-GCCUCGUAAAA----------AGCCUCAA-----AAGAUAAAUGCAAAUAAUACUACA---------------------------------------------UAUAGAGAAUCUGUUGCUUUAGCAGCUUAA---------------------AUCAGACUAAUAUUCUGAAGGUUC---------------CCUCUCGUUUCAAUAUUU--------------ACUCUUAGAUAUUAAAAAAUAAAUAGAGAGG------------------------------------------------CCAUAUA-AAUAAGAGUGC-GCGU--AAAUGCUU-----------GCUUUUGGCUUA--ACGU--UAAGUAUA--AAAAGC-UA------GUUGGUUAG-UGAUUGGUCUUGAUAUAUCUACGCCAAU------UAAAUGUAA---UUCAAGACCUAAGCA-UGUAG---------------------GUUACUAAAAAUAAA----AAGAAUUCUGGAC-GCGGGUUCGAACCCCGC-CAGCUCCACCA Bpe2t1
Hde2t2      GGGGCUG----AUUCUGGA--UUCGACGGGAUAAGC-----AAAGCCC-AAGGUGCAUGC--CGAGG--GGCGGUU--GCCUCGUAAAA-----------AACCGUG---AAAAAAUAGUNNNNNNNNNNNNNNNN------------------------------------------------------NNNNNNNNNNNNNNNNNNNNN---------------------NNNNNNNNNNNNNNN------------------------NNNNNNNNNNNNNNNNNN--------------NNNNNNNNNNNNNNNNN--NNNNNNNNNN--------------------------------------------------NNNNN---NNNNNNNNNNN-NNNNNNNNNNNN------------NNNNNNNNNNNNN-NNNNN-NNNNNNNN-NNNNNNNN-NN--------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN--------NNNNNNNNNNNN-NNNNNNNNNNNNNN-NNNNN----------------------NNNNNNNNNNNN------NNNNNNNNNNNNN-NNNNNNNNNNNNNNNNN-NNNNNNNNNNN Hde2t2
Bap5t15     GGGGCUG----UUUUUGGA--UUUGACAAAAUUAUC-----AACAAAGUAAAGUGCAUGC--CGAGG--AACGGUUU-GCCUCGAUAA-----------AAGCCGUA---AAAAAAUAAUUGCAAAUAAUAAACAA------------------------------------------------------AACUACGCUUUAGCAGCUUAA---------------------AAAACUGAAUAAAGC------------------------CCUUCCUUCUUAUCCUCC--------------UUCUCUUAGGAUGAGAA--AACAGGAAGG--------------------------------------------------UCAGA---AAAAGAGAAAA-ACGUGGAUAUCA------------AGCUUGACGAUAA-CACGA-AGUAGUUU-UUUCAAGC-UA--------UAUACCUAAUAUGUGUUUUUCCAAAUUAGGUAAU--------GAAUUCAAUAAA-GAAAAAACUAAGCA-UGUAG----------------------GGCUUUAUUAGU------AGAAAUUUUGGAC-GCGGGUUCGAAUCCCGC-CAGCUCCAaaa Bap5t15
Bap11t7     GGGGCUG----UUUUUGGA--UUCGACAAAGUUAUC-----AAAAAAGUAAAGUGCAUGC--CGAGG--AACGGUUU-GCCUCGAUAAA----------AAACCGUA---AAAAAAUAGCUGCAAAUAAUAAACAA------------------------------------------------------AACUACGCUUUAGCAGCUUAA---------------------AAAACUGUAUAAAGC------------------------CCUUUCAUCUCUGACUUC---------------UCUCUUGAGAACGAGAAAUUUUUAAGAAAGG-----------------------------------------------CCGACAUUUAAAGAGAAAA-AUGUGAGCACUA------------UGCUUGAUAGUGA-CACAA-AAUUAAUUU-UUCAAGC-UA--------UAAGCUUAAAAUGAGUUUUUCCAAAUUAAGCAAU--------GAAAA-AAUAAA-GAA-AAACUAAGCA-UGUAG---------------------UAUCUUUAUUUAU------AGAAAUUUUGGAC-GCGGGUUCAAAUCCCGC-CAGCUCCAaaa Bap11t7
Bap6t1      GGGGCUG----AUAUUGGA--UUUGACAAAAUUAUU-----GAAAACU-GAUGUGCAUGC--CGAGG---AUGGUUU-GCCUCGUUAAA----------AAACCAUA----AAAAAUAGUAGCAAAACAAAAUCAA---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAAUCUGAAUAAAGC------------------------CCUUCUUUUAAACAUAU----------------UCUCUUAAUGUUUAAUUUAUAUAGAAGG--------------------------------------------------UUAAU--CUAAAGAGAUC--GCAACUCAAAUCUA----------UUUUGAAAGAUUUUUUGUUGCUAAAUAAAAACUUCAAAAUA-------UAUAUCUAUAAUGAGUCUAUACAUCGAUAGAUAA--------GAAAAGAUA-----AUA-GACUAAGCA-UGUAG---------------------UAUCUGAAGUCGU------AAAAAUUUUGGAC-GCGGGUUCGAAUCCCGC-CAGCUCCAaaa Bap6t1
Pas2t2      GGGGCUG----AUUCUGGA--UUCGACGGGAUUCGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAA-----------AAGCCGCA---AAAAAAUAGUUGCAAACGACAACGAA---------------------------------------------------------UACGCACUAGUAGCUUAA---------------------UAACCUGCAUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGAUCA--AGGGAGG--------------------------------------------------UCAAACCUAAAAGAGAUC--GCGU-GGAUGCCUU-----------GCCUGGGGUU-GAAGCGU--UAAAUCUAA-UCAGGC-UA-------GUUUGUUAGUGGCGUGUCUAUCCGCAGCUGGCAAGU-------GAAUGUAAA----GAUUAGACUAAGCA-UGUAG----------------------UACCAAGGAUGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Pas2t2
Plu4t3      GGGGCUG----AUUCUGGA--UUCGACGGGAUUCGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAA-----------AAGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAA---------------------------------------------------------UACGCACUAGCAGCUUAA---------------------UAACCUGCGCAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGAUCA--AGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAUGCCUU-----------GCCUGGGGUU-GAAGCGU--UAAAUCUAA-UCAGGC-UA-------GUUUGUGAGUGGCGUGUCUGUCCGCAGCUGGCAAGC-------GAAUGUAAA----GAUUAGACUAAGCA-UGUAG----------------------UACCAAGGAUGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Plu4t3
Sdy4t2      GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA----AAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAAGCCCU------------GCCUGGGGUUGAAGCGU--UAAAACUUAAUCAGGC-UA-------GUUUGUUAGUGGCGUGUCCGUCCGCAGCUGGCAAGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGACGU------AGGAAUUCCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Sdy4t2
Sdy4t2      GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA----AAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAAGCCCU------------GCCUGGGGUUGAAGCGU--UAAAACUUAAUCAGGC-UA-------GUUUGUUAGUGGCGUGUCCGUCCGCAGCUGGCAAGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGACGU------AGGAAUUCCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Sdy4t2
Eco655t329  GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA----AAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAAGCCCU------------GCCUGGGGUUGAAGCGU--UAAAACUUAAUCAGGC-UA-------GUUUGUUAGUGGCGUGUCCGUCCGCAGCUGGCAAGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGACGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Eco655t329
Eco1t778    GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA----AAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAAGCCCU------------GCCUGGGGUUGAAGCGU--UAAAACUUAAUCAGGC-UA-------GUUUGUUAGUGGCGUGUCCGUCCGCAGCUGGCAAGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Eco1t778
Eco1t778    GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA----AAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAAGCCCU------------GCCUGGGGUUGAAGCGU--UAAAACUUAAUCAGGC-UA-------GUUUGUUAGUGGCGUGUCCGUCCGCAGCUGGCAAGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Eco1t778
Eco1t778    GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA----AAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAAGCCCU------------GCCUGGGGUUGAAGCGU--UAAAACUUAAUCAGGC-UA-------GUUUGUUAGUGGCGUGUCCGUCCGCAGCUGGCAAGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Eco1t778
Eco160t1    GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA----AAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAAGCCCU------------GCCUGGGGUUGAAGCGU--UAAAACUUAAUCAGGC-UA-------GUUUGUUAGUGGCGUGUCCGUCCACAGCUGGCAAGC-------GAAUGUAAA----GAC-URACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGAAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Eco160t1
Eco655t329  GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA----AAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAAGCCCU------------GCCUGGGGUUGAAGCGU--UAAAACUUAAUCAGGC-UA-------GUUUGUUAGUGGCGUGUCCGUCCGCAGCUGGCAAGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGACGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Eco655t329
Eco246t1    GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA----AAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGAUGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAAGCCCU------------GCCUGGGGUUGAAGCGU--UAAAACUUAAUCAGGC-UA-------GUUUGUUAGUGGCGUGUCCGUCCGCAGCUGGCAAGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Eco246t1
Ecl1t1      NNNNNNN----NNNNNNNN--NNNNNNGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUU-GCCUCGUUAA-----------AAGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUCUGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGAUGGGGA-UCAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAAGCCCU------------GCCUGGGGUUGAAGCGU--UAAAACU-AAUCAGGC-UA-------GUUCGUUAGUGGCGUGUCUGUCCGCAGCUGGCGUGC-------GAAUGUAAA----GAC-AAACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGAAAUUUCGGAC-GCGGNNNNNNNNNNNNN-NNNNNNNNNNN Ecl1t1
Eae1t2      NNNNNNN----NNNNNNNN--NNNNNNGGGAUUCGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACUCAAAAGAGAUC--GCGC-GGAUGCCCU------------GCCUGGGGUUGAAGUGC--UAAAACU-AAUCAGGC-UA-------GUUCGUUAGUGGCGUGUCUGUCCGCAGCUGGCGUGC-------GAAUGUAAA----GAC-AAACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGGNNNNNNNNNNNNN-NNNNNNNNNNN Eae1t2
Csa8t4      GGGGCUG----AUUCUGGA--UUCGACGGGAUUCGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAUGCCCU------------GCCUGGGGUUGAAGCGU--UAAA-ACUAAUCAGGC-UA-------GUCUGGUAGUGGCGUGUCCGUCCGCAGCUGCCAGGC-------GAAUGUAAA----GACCGGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Csa8t4
Pre1t1      NNNNNNN----NNNNNNNN--NNNNNNGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUU-GGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAUGCCUU------------GCCUGGGGUUGAAGCGU--UAAA-CUUAAUCAGGA-UA-------GUUUGUUGGUGGCGUGUCUGUCCGCAGCUGGCAAAU-------GAAUUCAAA----GACUAGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGAAAUUUCNNNN-NNNNNNNNNNNNNNNNN-NNNNNNNNNNN Pre1t1
Sma1t3      NNNNNNN----NNNNNNNN--NNNNNNGGGAUUUGC-----GAAGCCC-UAGGAGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UACCCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGACGUCCU------------GCCUGGGGCUGAAGCGU--UAAA-CUCAAUCAGGC-UA-------GUCUGUCAGUAGCGUGUCCAUCCGCAGCUGGCCGGC-------GAAUGUAAA----GAUUGGACUAAGCA-UGUAG----------------------UGCCGACGGUGU------AGUAAUUUCGGAC-GGGGNNNNNNNNNNNNN-NNNNNNNNNNN Sma1t3
Sma2t3      GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAGCCC-UAGGAGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UACCCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAUGUCCU------------GCCUGGGGCUGAAGCGU--UAAA-CUCAAUCAGGC-UA-------GUCUGUCAGUAGCGUGUCCAUCCGCAGCUGGCCGGC-------GAAUGUAAA----GAUUGGACUAAGCA-UGUAG----------------------UGCCGACGGUGU------AGUAAUUUCGGAC-GGGGGUUCAAAUCCCCC-CAGCUCCACCA Sma2t3
Pst1t1      GGGGCUG----AUUCUGGA--UUCGACGGGAUU-GU-----GAAGCCU-UAGGAGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUGAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------ACUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAUGCCCU------------GCCUGGGGUUGAAGCGU--UAAA-CUUAAUCAGGC-UA-------GUCUGUCAGUGGCGUGUCCGUCCGCAGCUGACCGGC-------GAAUGUAAA----GACUGGACUAAGCA-UGUAG----------------------UGCCGACGGUGU------AGUAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Pst1t1
Pmi5t7      GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAGAUAGUCGCAAACGACAAUCAA------------------------------------------------------UAUAAAGCACUAGCAGCUUAA---------------------UAACCUGCCUAGAGC------------------------CUUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA--UAAAGAGGAG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAUGCCUA------------GCUUGGGGUUGAAGCGU--UAAA-UUUAAUCAAGC-UA-------GCUUAUUUGUGGCGUGUCUGUCCGCAGCAAGUAAGU-------GAAUUUAAA----GACUAGACUAAGCA-UGUAG----------------------UGCCGCGGAUGU------AGAAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Pmi5t7
Pvu1t1      NNNNNNN----NNNNNNNN--NNNNNNGGAAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAGAUAGUCGCAAACGACAAUCAG------------------------------------------------------UACGAAGCACUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGU-GGAAACCUA------------GCUUGGGGUUGAAGCGU--UAAA-UAUAAUCAAGC-UA-------GCUUAUUUGUGGCGUGUCUGUUCGCAGCAAGUAAGU-------GAAAUUAAA----GAC-AGACUAAGCA-UGUAG----------------------UGCCGCGGAUGU------AGGAAUUUCGGAC-GGGGNNNNNNNNNNNNN-NNNNNNNNNNN Pvu1t1
Kpn57t114   GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA----AAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUCUGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA-UCAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAUGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAUCU-AAUCAGGC-UA-------GUUUGUUAGUGGCGUGUCUGUCCGCAGCUGGCAAGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UGCCGAGGAUGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Kpn57t114
Pat3t3      GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----AAAGCCC-AAGGUGCAUGC--CGAGG--GGCGGUUU-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUAAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAUGCCCU-------------GCCUGGGGUUGAAGGGC--UAAAUCU-AAUCAGGC-UA-------GUUUGUUAGUGGCGUGUCUGUCCGCAGCUGGCAAGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGACGGUAG------AGUAGUUCCGGAC-GGGGGUUCAAAUCCCCC-CAGCUCCACCA Pat3t3
Eam3t12     GGGGCUG----AUUCUGGA--UUCGACAGGAUUUGC-----AAAGCCC-UAGGAGCAUGC--CGAGG--GGCGGUUU-GCCUCGUUAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC------------------------------------------------UUCGCACCUGCUGCUUUAGCAGCUUAA-------------UCAGCUUAAUAAACUGAAGGUGU------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAAACUAAAAGAGAUC--GCGUGGAUGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAUCC-AAUCAGGC-UA-------GUUUGUUAGUAGCGUGUCCGUUCGCAGCUAACCGGC-------GAAUGUAAU----AACUGGACUAAGCA-UGUAG----------------------UGCCGACGGUGU------AGUAAUUCUGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Eam3t12
Dda1t2      GGGGCUG----AUUCUGGA--UUCGACGGGAUUCGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC------------------------------------------------UUCGCACCUGCUGCUUUAGCAGCUUAA-------------UCAGCCUAAGAAACUGAAGGUGU------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCUAAAAGAGAUC--GCGUGGAUGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAUCC-AAUCAGGC-UA-------GUUUGUUAGUGGCGUGUCUGUCCGCAGCUGGCAAGC-------GAAUGUAAA----GACCAGACUAAGCA-UGUAG----------------------UACCGACGGUGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Dda1t2
Sbo2t2      GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAGACCCU-------------GCCUGGGGUUGAAGCGU--UAAAACG-AAUCAGGC-UA-------GUCUGGUAGUGGCGUGUCGGUCCGCAGGUGCCAGGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Sbo2t2
Sen336t104  GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAACC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGCGGAUGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAACG-AAUCAGGC-UA-------GUCUGGUAGUGGCGUGUCCGUCCGCAGGUGCCAGGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Sen336t104
Sen328t4    GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGCGGAUGCCCU-------------GCCUGGGGUUGAGGCGU--UAAAACG-AAUCAGGC-UA-------GUCUGGUAGUGGCGUGUCCGUCCGCAGGUGCCAGGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Sen328t4
Sen88t141   GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAACC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAUGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAACG-AAUCAGGC-UA-------GUCUGGUAGUGGCGUGUCCGUCCGCAGGUGCCAGGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Sen88t141
Sen6t1      NNNNNNN----NNNNNNNN--NNNNACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG-GGCUGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA-UCAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAUGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAACG-AAUCAGGC-UA-------GUCUGGUAGUGGCGUGUCCGUCCGCAGGUGCCAGGC-------GAAUGUAAA----GAC-AGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN Sen6t1
Sen7t1      GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAACC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAUGCCUU-------------GCCUGGGGUUGAAGCGU--UAAAACG-AAUCAGGC-UA-------GUCUGGUAGUGGCGUGUCCGUCCGCAGGUGCCAGGC-------GAAUGUAAA----GAC-AGACUAAGCA-UGUCC----------------------UUCCGAGGAUGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Sen7t1
Sen79t135   GGGGCUG----AUUCUGGA--UUCGACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGCGGAUGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAACG-AAUCAGGC-UA-------GUCUGGUAGUGGCGUGUCCGUCCGCAGGUGCCAGGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Sen79t135
Cro1t1      GGGGCUG----AUUCUGGA--UUCGACGGGAUUCGC-----GAAACCC-AAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGUUAAU----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUCAGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA-UCAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAUGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAACU-AAUCAGGC-UA-------GUCUGGUAGUGGCGUGUCCGUCCGCAGGUGCCAGGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Cro1t1
B1t20       NNNNNNN----NNNNNNNN--NNNNACAAGAUUCAC-----GAAACCC-AAGGUGCAUGC--CGAGG--UGCGGUAG-GCCUCGUUAAC----------AAACCGCA----AAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUAGCAGCUUAA---------------------UACCCUGCUUAGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA--UAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCAUGGAAGUCCU-------------GCCUGGGGCUAAAGUGC--UAAAUCU-AAUCAGGC-UA-------GUUUGUUAGUGGCGUGUCCAUCCGCAGCUGACCGGC-------GAAUGUAAA----GAUUGGACUAAGCA-UGUAG----------------------UGCCGACGGUGU------AGCAAUUUCGGAC-GGGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t20
B1t6        NNNNNNN----NNNNNNNN--NNNNACAGGAUUUGC-----AAAGCCC-UAGGAGCAUGC--CGAGG--GGCGGUUU-GCCUCGUAAAA-----------AGCCGCA----AAAAAUAGUUGCAAACGACGAAAAC---------------------------------------------------------UACGCACUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GUUCUUAAGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCUAAAAGAACUC--GCGUGAAUACCUU-------------GCCUGGGGUUGAAGCGC--UAAAAUCUAAUCAGGC-UA-------GUUUGUCAGUGGCGUGUCCGUUCGCAGCUGACCGGC-------GAAUGUAAA----GAU-GGACUAAGCA-UGUAG----------------------UGCCGACGGUGU------AGUAAUUCUGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t6
B1t3        NNNNNNN----NNNNNNNN--NNNNACAGGAUUUGC-----AAAGCCC-UAGGAGCAUGC--CGAGG--GGCGGUUU-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUUGCAAACGACGAAAAC---------------------------------------------------------UACGCACUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GUUCUUAAGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCUAAAAGAACUC--GCGUGAAUACCUU-------------GCCUGGGGUUGAAGCGC--UAAAAUCUAAUCAGGC-UA-------GUUUGUCAGUGGCGUGUCCGUUCGCAGCUGACCGGC-------GAAUGUAAA----GAU-GGACUAAGCA-UGUAG----------------------UGCCGACGGUGU------AGUAAUUCUG-AC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t3
B1t27       NNNNNNN----NNNNNNNN--NNNNACAGGAUUUGC-----AAAGCCC-UAGGAGCAUGC--CGAGG--GGCGGUUU-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUUGCAAACGACGAAAAC---------------------------------------------------------UACGCACUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GUUCUUAAGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCUAAAAGAACUC--GCGUGAAUACCUU-------------GCCUGGGGUUGAAGCGC--UAAAAUCUAAUCAGGC-UA-------GUUUGUCAGUGGCGUGUCCCUCCGCAGCGUG-UUGC-------GAAUGUAAA----GAG-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGUAAUUUUGGAC-GGGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t27
B1t33       NNNNNNN----NNNNNNNN--NNNNACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGAUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCUCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUAAGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA--UAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGCGGAUGUCCU-------------GCCUGGGGCUGAAGUGC--UAAAACU-AAUCAGGC-UA-------GUUCGUUAGUGGCGUGUCUGUCCGCAGCUGGCGUGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UGCCGAGGAUGU------AGGAAUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t33
B1t35       NNNNNNN----NNNNNNNN--NNNNACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGGGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUAAGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA--UAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGCGGAUGUCCU-------------GCCUGGGGCUGAAGUGC--UAAAACU-AAUCAGGC-UA-------GUUCGUUAGUGGCGUGUCUGUC-GCAGCUGGCGUGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t35
B1t7        NNNNNNN----NNNNNNNN--NNNNACGGGAUUCGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUAAGAGC------------------------CCUCUCACCCUAGCUUCC---------------GCUCUUAAGACGGGGA--UAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGCGGAUGUCCU-------------GCCUGGGGCUGAAGUGC--UAAAACU-AAUCAGGC-UA-------GUUCGUUAGUGGCGUGUCUGUCCGCAGCUGGCGUGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t7
B1t25       NNNNNNN----NNNNNNNN--NNNNACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA----AAAAAUAGUCGCAAACGUCGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUAAGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA--UAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGCGGAUGUCCU-------------GCCUGGGGCUGAAGUGC--UAAAACU-AAUCAGGC-UA-------GUUCGUUAGUGGCGUGUCUGUCCGCAGCUGGCGUGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UGCCGAGGAUGU------AGGAAUUUCGGAC-GUGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t25
B1t29       NNNNNNN----NNNNNNNN--NNNNACGGGAUUCGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGGAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUAAGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA--UAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGACC--GCGCGGAUGUCCU-------------GCCUGGGGCUGAAGUGC--UAAAACU-AAUCAGGC-UA-------GUUCGUUAGUGGCGUGUCUGUCCGCAGCUGGCGUGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UGCCGAGGAUGU------AGGAAUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t29
B1t16       NNNNNNN----NNNNNNNN--NNNNACGGGAUUUGC-----GAAACCC-AAGAUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUAAGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA-UCAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAGGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAUCU-AAUCAGGC-UA-------GUCUGGUAGUGGCGUGUCUGUCCGCAGGUGCCAGGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t16
B1t22       NNNNNNN----NNNNNNNN--NNNNACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUAAGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA-UCAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAGGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAUCU-AAUCAGGC-UA-------GUCUGGUAGUGGCGUGUCUGUCCGCAGGUGCCAGGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t22
B1t24       NNNNNNN----NNNNNNNN--NNNNACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUAAGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA-UCAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAGGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAACU-AAUCAGGC-UA-------GUCUGGUAGUGGCGUGUCUGUCCGCAGGUGCCAGGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UGCCGAGGAUGU------AGGAAUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t24
B1t2        NNNNNNN----NNNNNNNN--NNNNACGGGAUUCGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUCUGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA-UCAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAGGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAACU-AAUCAGGC-UA-------GUCUGGUAGUGGCGUGUCUGUCCGCAGGUGCCAGGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------CGCCGAGGAUGU------AGGAAUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t2
B1t12       NNNNNNN----NNNNNNNN--NNNNACGGGAAUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGGGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA-UCAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAUGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAACU-AAUCAGGC-UA-------GUCUGGUAGUGGCGUGUCCGUCCGCAGGUGCCAGGC-------GAAUGUAAA----GAC-AGACUUAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t12
B1t4        NNNNNNN----NNNNNNNN--NNNNACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA-UCAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAUGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAACG-AAUCAGGC-UA-------GUCUGGUAGUGGCGUGUCCGCCCGCAGGUGCCAGGC-------GAAUGUAAA----GAC-AGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t4
B1t28       NNNNNNN----NNNNNNNN--NNNNACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCGCGUAAAA-----------AGCCGCA----AUAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAAGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAACUUAAUCAGGC-UA-------GUUUGUUAGUGGCGUGUCCGUCCGCAGCUGGCAAGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t28
B1t31       NNNNNNN----NNNNNNNN--NNNNACGGGAUUUGC-----GAAGCCC-UAGGAGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UACCCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAUGUCCU-------------GCCUGGGGCUGAAGCGU--UAAACUC-AAUCAGGC-UA-------GUCUGUCAGUAGCGUGUCCAUCCGCAGCUGGCCGGC-------GAAUGUAAA----GAU-UGACUAAGCA-UGUAG----------------------UGCCGACGGUGU------AGUAAUUUCGGAC-GGGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t31
B1t1        NNNNNNN----NNNNNNNN--NNNNACGGGAUU-GU-----GAAGCCU-UAGGAGCAUGC--CGAGG--GGCGGUUU-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCACUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CUUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA-UC-AAGAGAAG--------------------------------------------------UCAAACCCAAAAGAGCUC--GUGUGGAUGUCUU-------------GCCUGGGGCUGAAGCAC--UAAAACU-AAUCAGGA-UA-------GUUUGGUAAUGGCGUGUCUAUCCGCAGUUGCCCGGC-------GAAUGUAAA----GAUAUGACUAAGCA-UGUAG----------------------UGCCGACGGUGU------AGUAAUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t1
B1t11       NNNNNNN----NNNNNNNN--NNNNACGGGAUUCGC-----GAAACCC-AAGGUGCAUGC--CGAGG--GGCGGUUG-GCCUCGUAAAA-----------AGCCGCA---AAAAAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UGCGCUUUAGCAGCUUAA---------------------UAACCUGCUAAGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA-AUAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAAGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAACU-AAUCAGGC-UA-------GUUUGUCAGUGGC--GUUCCUCCGCAGCUGGCCAGC-------GAAUGUAAA----GACUGGACUAAGCA-UGUAG----------------------UGCCGAGGAUGU------AGGAAUUUCGGAC-GCGNNNNNNNNNNNNNN-NNNNNNNNNNN B1t11
B1t23       NNNNNNN----NNNNNNNN--NNNNACGGGAUUUGC-----GAAACCC-AAGGUGCAUGC--CGAGG---GCGGUUG-GCCUCGUAAAA-----------AGCCGCAAAAAAAAUAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUCUGAGC------------------------CCUCUCUCCCUAGCUUCC---------------GCUCUUAAGACGGGGA-UCAAAGAGAGG--------------------------------------------------UCAAACCCAAAAGAGAUC--GCGUGGAGGCCCU-------------GCCUGGGGUUGAAGCGU--UAAAUCU-AAUCAGGC-UA-------GUCUGGUAGUGGCGUGUCUGUCCGCAGGUGCCAGGC-------GAAUGUAAA----GAC-UGACUAAGCA-UGUAG----------------------UACCGAGGAUGU------AGGAAUUUCGGAC-GCNNNNNNNNNNNNNNN-NNNNNNNNNNN B1t23
Ype103t229  GGGGCUG----AUUCUGGA--UUCGACGGGAUUCGC-----GAAACCC-AAGGUGCAUGC--CGAGG--UGCGGU-G-GCCUCGUAAAA-----------AACCGCA--AAAAAAAUAGUUGCAAACGACGAAAAC---------------------------------------------------------UACGCACUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCUAAAAGAGCUC--GUGUGGAAACCUU-------------GCCUGGGGUGGAAGCAU--UAAAAC-UAAUCAGGA-UA-------GUUUGUCAGUAGCGUGUCCAUCCGCAGCUGGCCGGC-------GAAUGUAAU----GAUUGGACUAAGCA-UGUAG----------------------UGCCGACGGUGU------AGUAAUUUCGGAC-GGGGGUUCAAAUCCCCC-CAGCUCCACCA Ype103t229
Ype103t229  GGGGCUG----AUUCUGGA--UUCGACGGGAUUCGC-----GAAACCC-AAGGUGCAUGC--CGAGG--UGCGGU-G-GCCUCGUAAAA-----------AACCGCA--AAAAAAAUAGUUGCAAACGACGAAAAC---------------------------------------------------------UACGCACUAGCAGCUUAA---------------------UAACCUGCUUAGAGC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCUAAAAGAGCUC--GUGUGGAAACCUU-------------GCCUGGGGUGGAAGCAU--UAAAAC-UAAUCAGGA-UA-------GUUUGUCAGUAGCGUGUCCAUCCGCAGCUGGCCGGC-------GAAUGUAAU----GAUUGGACUAAGCA-UGUAG----------------------UGCCGACGGUGU------AGUAAUUUCGGAC-GGGGGUUCAAAUCCCCC-CAGCUCCACCA Ype103t229
Yen9t25     GGGGCUG----AUUCUGGA--UUCGACGGGAUUCGC-----GAAACCC-AAGGUGCAUGC--CGAGG--UGCGG-AG-GCCUCGUAAAA-----------AACCGCA--AAAAAAAUAAUUGCAAACGACUCGCAA------------------------------------------------UACGAAUCUGCUGCUUUAGCAGCUUAA-------------UCAGCCUAAGAAACUGAAGAUUC------------------------CCUCUCUCCCUAGCCUCC---------------GCUCUUAGGACGGGGA--UCAAGAGAGG--------------------------------------------------UCAAACCUAAAAGAGAUC--GCGUGGACACCUU-------------GCCUGGGGUGAAAGCGU--UAAACC-CAAUCAGGA-UA-------GUUUGUUAGUGGCGUGUCCGUCCGCAGCUAACCGGC-------GAAUGUAAU----GACUGGACUAAGCA-UGUAG----------------------UGCCGACGGCGU------AGUAAUUUCGGAC-GGGGGUUCAAAUCCCCC-CAGCUCCACCA Yen9t25
Pasteurellales
Mha5t11     GGGGCUG----AUUUUGGA--UUCGACGGGAUUGGC-----GAAGCCC-AAGGUGCAUGU--CGAGG--UGCGGUAG-GCCUCGUAAAC----------AAACCGCA---AAAUAAUAGUCGCAAACGACGAACAA---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUUUAAAGC-----------------------CUUAUCUCCUCAGCUUCC---------------GCUCGUAAGACGAGGG--CAAAGAUAAG--------------------------------------------------UCAC-CCAAAACGAGAUC--GUGUGGACGCCGCC-----------GCUUUAGGAUCGAAACAC--UAAA-UUAAAUAAAGC-UA-------GUUUAUUCAUUGCGUGUCUGUCCGCUGUGAAUAAGC-------GAAAUUAAA----GACUAGACUAAACA-UGUAG----------------------UACUGAAGGUAG------AGAAAUUUCGGAC-GGGGGUUCAAAUCCCCC-CAGCUCCACCA Mha5t11
Msu1t1      GGGGCUG----AUUCUGGA--UUCGACGGGAUUGGC-----GAAGCCC-AAGGUGCACGU--CGAGG--UGCGGUAG-GCCUCGUAAAU----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAACAA---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCAUUUAGC------------------------CUUCGCUCCCUAGCUUCC---------------GCUCGUAAGACGGGGA--UCAAGCGGAG--------------------------------------------------UCAAACCUAAACGAGAUC--GUGUGGACGCUUCG-----------GCUUGGAGAUCGAAACAC--UAAA-UUGAAUCAAGC-UA-------GUUUAUUCUUCGCGUGUCUGUCCGCAGGGGGUAAAU-------GAAAUUAAA----GACUAGACUAAACG-UGUAG----------------------UGCUGAAGGUAG------AGUAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Msu1t1
Hdu1t1      GGGGCUG----AUUCUGGA--UUCGACGGGAUUAGC-----GAAGUCC-AAGGUGCACGU--CGAGG--UGCGGUAG-GCCUCGUAAAC----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAACAA---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCAUUUAGC------------------------CUUCGCGCCCUAGCUUUC---------------GCUCGUAAGACGGGGA--GCACGCGGAG--------------------------------------------------UCAAACCAAAACGAGAUC--GUGUGGACGCUUCG-----------GCUUGUAGAUCGAAACAC--CAAA-UUGAAUCAAGC-UA-------GUUUAUUUCUUGCGUGUCUGUCCGCUGGAGAUAAGC-------GAAAUUAAA----GACCAGACUAAACG-UGUAG----------------------UACUGAAGAUAG------AGUAAUUUCGGAC-GGGGGUUCAAAUCCCCC-CAGCUCCACCA Hdu1t1
Hin15t15    GGGGCUG----AUUCUGGA--UUCGACGGGAUUAGC-----GAAGCCC-AAGGUGCACGU--CGAGG--UGCGGUAG-GCCUCGUAAAU----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAACAA---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCAUUUAGC------------------------CUUCGCGCUCCAGCUUCC---------------GCUCGUAAGACGGGGA--UAACGCGGAG--------------------------------------------------UCAAACCAAAACGAGAUC--GUGUGGAAGCCACC-----------GUUUGAGGAUCGAAGCAC--UAAA-UUGAAUCAAAC-UA-------GCUUAAGUUUAGCGUGUCUGUCCGCA-UGCUUAAGU-------GAAAUUAAA----GACGAGACUAAACG-UGUAG----------------------UACUGAAGGUAG------AGUAAUUUCGGAC-GGGGGUUCAACUCCCCC-CAGCUCCACCA Hin15t15
Hin14t2     GGGGCUG----AUUCUGGA--UUCGACGGGAUUAGC-----GAAGCCC-AAGGUGCACGU--CGAGG--UGCGGUAG-GCCUCGUAAAU----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAACAA---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCAUUUAGC------------------------CUUCGCGCUCCAGCUUCC---------------GCUCGUAAGACGGGGA--UAACGCGGAG--------------------------------------------------UCAAACCAAAACGAGAUC--GUGUGGAAGCCACC-----------GUUUGAGGAUCGAAGCAC--UAAA-UUAAAUCAAAC-UA-------GCUUAAGUUUAGCGUGUCUGUCCGCA-UGCUUAAGU-------GAAAUUAAA----GACGAGACUAAACG-UGUAG----------------------UACUGAAGGUAG------AGUAAUUUCGGAC-GGGGGUUCAACUCCCCC-CAGCUCCACCA Hin14t2
Hin13t1     GGGGCUG----AUUCUGGA--UUCGACGGGAUUAGC-----AAAGCCC-AAGGUGCACGU--CGAGG--UGCGGUAG-GCCUCGUAAAU----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAACAA---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCAUUUAGC------------------------CUUCGCGCUCCAGCUUCC---------------GCUCGUAAGACGGGGA--UAACGCGGAG--------------------------------------------------UCAAACCAAAACGAGAUC--GUGUGGAAGCCACC-----------GUUUGAGGAUCGAAGCAC--UAAA-UUGAAUCAAAC-UA-------GCUUAAGUUUAGCGUGUCUGUCCGCA-UGCUUAAGU-------GAAAUUAAA----GACGAGACUAAACG-UGUAG----------------------UACUGAAGGUAG------AGUAAUUUCGGAC-GGGGGUUCAACUCCCCC-CAGCUCCACCA Hin13t1
Hin3t8      GGGGCUG----AUUCUGGA--UUCGACGGGAUUAGC-----GAAGCCC-AAGGUGCACGU--CGAGG--UGCGGUAG-GCCUCGUAAAU----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAACAA---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCAUUUAGC------------------------CUUCGCGCUCCAGCUUCC---------------GCUCGUAAGACGGGGA--UAACGCGGAG--------------------------------------------------UCAAACCAAAACGAGAUC--GUGUGGAAGCCACC-----------GUUUGAGGAUCGAAGCAC--UAAA-UUGAAUCAAAC-UA-------GCUUAAGUUUAGCGUGUCUGUCCGCA-UGCUUAAGU-------GAAAUUAAA----GACGAGACUAAACG-UGUAG----------------------UGCUGAAGGUAG------AGUAAUUUCGGAC-GGGGGUUCAACUCCCCC-CAGCUCCACCA Hin3t8
Hso2t2      GGGGCUG----AUUUUGGA--UUCGACGGAAUUAGC-----GAAGCCC-AAGGUGCACGU--CGAGG--UGCGGUAG-GCCUCGUAAAU----------AAACCGCA---AAACAAUAGUCGCAAACGACGAACAA---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUCAUAGC------------------------CUUCACUCCCUAGCUUUC---------------GCUCGUAAGACGGGGA--UAAAGUGGAG--------------------------------------------------UCAAAUCCAAACGAGAUC--GUGUUGAAGCCGCC-----------GCUUUAGGAUCGAAGCAU--UAAA-UUGAAUAAAGC-UA-------GUUUUUUGAUGGCGUGUCUGUCCGCAGUCAAUUUAC-------GAAAUUAAA----GAUUAGACUAAACG-UGUAG----------------------GACUGAAGGUAG------AGUAAUUUCGGAC-GGGGGUUCAACUCCCCC-CAGCUCCACCA Hso2t2
Pmu14t2     GGGGCUG----AUUCUGGA--UUCGACGGGAUUAGC-----GAAGCCC-AAGGUGCACGU--CGAGG--UGCGGUAG-GCCUCGUAAAU----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAACAA---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUCAUAGC------------------------CUUCUCUCCCCAGCUUCC---------------GCUCGUAAGACGGGGA--UCAAGAGGAG--------------------------------------------------UCAAAUUCAAACGAGAUC--GCGUGGACGCCUCC-----------GCUUGAGGAUCGAAGCGU--UAAA-UUGAAUCAAGC-UA-------GUUUAUCUAUCGCGUGUCUGUCCGCAGUGGGUAAAU-------GAAAUUAAA----GACGAGACUAAACG-UGUAG----------------------UACUGAAGGUAG------AGUAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Pmu14t2
Aac1t5      GGGGCUG----AUUCUGGA--UUCGACGGGAUUAGC-----GAAGCCC-GAAGUGCACGU--CGAGG--UGCGGUAG-GCCUCGUAAAU----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAACAA---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCCUUUAGC------------------------CUUCGCUCCCCAGCUUCC---------------GCUCGUAAGACGGGGA--UAAAGCGGAG--------------------------------------------------UCAAACCAAAACGAGCUC--GUGUGGAAGCCACC-----------GUUUGAGGAUCGAAGCAU--UAAA-UUAAAUCAAAC-UA-------GCUUAAUUGUCGCGUGUCCGUCCGCA-GGAUUAAGU-------GAAUUUAAA----GACCGGACUAAACG-UGUAG----------------------UGCUAACGGCAG------AGGAAUUUCGGAC-GGGGGUUCAACUCCCCC-CAGCUCCACCA Aac1t5
Asu1t1      GGGGCUG----AUUCUGGA--UUCGACGGGAUUGGC-----GAAGCCC-AAGGUGCACGU--CGAGG--UGCGGUAG-GCCUCGUAAAU----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAACAA---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCAUUUAGC------------------------CUUCGCUCCCCAGCUUCC---------------GCUCGUAAGACGGGGA--UCAAGCGGAG--------------------------------------------------UCAAACCUAAACGAGAUC--GUGUGGACGCUUCG-----------GCUUGGAGAUCGAAACAC--UAAA-UUGAAUCAAGC-UA-------GUUUAUUCUUCGCGUGUCUGUCCGCAGGGGAUAAAU-------GAAGUUAAA----GACCAGACUAAACG-UGUAG----------------------UGCUGAAGGUAG------AGUAAUUUCGGAC-GCGGGUUCAACUCCCGC-CAGCUCCACCA Asu1t1
Apl2t16     GGGGCUG----AUUCUGGA--UUCGACGGGAUUAGC-----GAAGUCC-AAGGUGCACGU--CGAGG--UGCGGUAG-GCCUCGUAAAC----------AAACCGCA---AAAAAAUAGUCGCAAACGACGAACAA---------------------------------------------------------UACGCUUUAGCAGCUUAA---------------------UAACCUGCUCAUAGC------------------------CUUAUCGCCUCAGCUUCC---------------GCUCGUAAGACGAGGG--CAACGAUAAG--------------------------------------------------UCAC-CCAAAACGAGAUC--GUGUGGACGCCGCC-----------GUUUGAGGAUCGAAACAC--UAAA-UUGAAUCAAAC-UA-------GCUUAUUUCUUGCGUGUCUGUCCGCUGGAGGUAAGU-------GAAAUUAAA----GACCAGACUAAACG-UGUAG----------------------UGCUGAAGAUGG------AGUAAUUUCGGAC-GGGGGUUCAAAUCCCCC-CAGCUCCACCA Apl2t16
ALPHA-PROTEOBACTERIA
Mitochondria
Ram1t1      GGGGAUG----UUUUUAGU-AUUCGACAUAGUGGAAUUUAUUUGUGGAAUUUUUAAAUUUUAUUUUUUUAUCUACUUUUAAGAAGGAUUUUUU****************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************AAAAACACCUUGUUAAAUAAGUAAAUAAAAAAAAUAAAAUUUAAAUUAUUUUUUUAUAAGAAUGACUAUGGAA-CCGAGGGCGGAUCUCGG-CAUCUCCAuaa Ram1t1
Ram3t1      GGGGAUG----UUUUUAGA-AUUCGACAUAGUACAAUAUUAUGAGA*********************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************UUUCGUAGUAACUAUGGAC-CCGAGGGCAGUUCUCGG-CAUCUCCAucu Ram3t1
Sec1t1      GGGAAUGAUAUAUACUAGA-GAUCGACAUUCAAAAAUGUAACCAAACAUAAAAAA******************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************************UUUUUAGACAAUCUAACGAAUGGAC-CCAUGGGCAGUUCAUGG-CAUUCCCAgua Sec1t1
Jli2t1      GGGGAUG-----AAUUAGU--UUAGAUAUUUAAGUAAUCCAUGAAAAUUCAUCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAUUUUGUAAUAUUGCUUAGAUAAAA-CCAUGGGCAGUACAUGG-CAUCUCCAcca Jli2t1
Caulobacterales
Ccr1t3      GGGGCCG------AUCAGC--AUCGACAGACGUG------UAAAGGUGUCUGCUUUCUCU--CGGC---UUGGCCC----ACCGUU-UC-----------GGGCC-----UUUAUCUAAAUGCGAACGAUAACUUC------------------------------------------------GCUGAAGAGUUCGCCGUCGCUGCGUAA--------------------UGCGGUGCAGGUGAAUUCGCC-------------------UCUUAAGU------------------------CCUAG-GGGUUCAGA-----------------------------------------------------------------------UCC-CUAGGCG--GGGCCC-------------------GGAGGGA-GCCU------GCCAACAGAA-UCCCUCCACCU****************************************************GUCCGGCUUCGGCCGAACUAUGGG-GAUAA----------------------ACGCGCACGUAA-----UAAGCGGACUGGAC-CCGGGUGCGAUUCCCGG-CGGCUCCACCA Ccr1t3
Rhodobacterales
Hne2t1      GGGGCCG-----AAAUAGU--GUCGACGGACGUG------UAAAGACGA-GGCUUUCGCU--CGC----UUGAGCU-----GCGUUAGA----------AGCUCAA---AAGCAAAUAGUUGCAAAUGACAACUUU------------------------------------------------GCUGAGGGCGAAUUGCUCGCCGCGUAA---------------------GCGGUGACGGUUUUUCCGA---------------------CCUAAGU------------------------CCUGG-GGCUUCAGA-----------------------------------------------------------------------CCC-CUAGGCG--GGGCCC-------------------GGGGGC--GCCU------GGCAACAGAA--GCCCCCACCU****************************************************GUC----UUCG----GACUAUGGC-GAUAA----------------------ACGCGCGUGUAA-----UAAGCGGCUCGGAC-CCGGGGGCGGUACCCGG-CGGCUCCACCA Hne2t1
Pde1t1      GGGGCCG-----AAACAGG--AUCGACGAACGUC------UAAAGCUGUUUGCUUUGUCU--CGGUG--AGCUAC----CACCGUCAUC-----------GGUGCA---AAAUGUACAGUUGCCAACGACAACCGU---------------------------------------------------GCUCCGGUGGCUCUGGCUGCGUAA---------------------GCAGCU-CGGGUAACCGAAA--------------------CUUAAGC------------------------CCUUCCGC-CUAG-C-----------------------------------------------------------------------AGCGUAAGGCG--GGGCCC-------------------GCAGGA--GCCU------GGCAACAGAA--UCCUGCACCU****************************************************GUUCGGGUUCGCCCGGACUAUGGA-CAUAA----------------------ACGCGCAGGUAA-----UAAGCGGAUCGGAC-CCGGGGGCGGUACCCGG-CGGCUCCACCA Pde1t1
Rsp1t7      GGGGCCG-----AAACAGG--AUCGACGAACGUC------UAAAGGGGUUGGCUUUGUCC--CGGUG--AGGUAC----CACCGUUAUC-----------GGUCCG---AAAAGUACAGUUGCCAACGACAACCGU---------------------------------------------------GCUCCGGUGGCUCUGGCUGCGUAA---------------------GCAGUU-CGAGUUAUCGAAA--------------------CUUAAGC------------------------CCUUGCGC-UUAG-C-----------------------------------------------------------------------CGCGUAAGGCG--GGGUUC-------------------GCAGGU--ACCU------GGCAACAGAA--ACCUGCACUU****************************************************GUCCGGGGCAACCCGGACUAUGGA-CAUAA----------------------ACGCGCUCGUCA-----UAAGCGGAUCGGAC-CCGGGGGCGGUACCCGG-CGGCUCCACCA Rsp1t7
Rpo1t1      GGGGCCG-----AAACAGG--AUCGACGGACGUC------UAAAGGGGUUAGCUUUGUCU--CGGCG--GGGUAC----CACCGUUAUC-----------GGUCCG---CAAAGCAUAAUUGCCAACGACAAUCGU---------------------------------------------------GCUCCGGUUGCUCUGGCUGCGUAA---------------------GCAGUC-CGAAACACCGAAA--------------------CUUAAGC------------------------CCUUGCGC-CUAG-C-----------------------------------------------------------------------AGCGUAAGGCG--GGGUUC-------------------GCAGGU--ACCU------GGCAACAGAA--ACCUGCAUUU****************************************************GUUCC--CUCG--GGAACUAUGGA-CAUAA----------------------ACGCGCUCGUAA-----UAAGCGGUUCGGAC-CCGGGGGCGGUACCCGG-CGGCUCCACCA Rpo1t1
Rtm1t1      GGGGCCG-----AAAUAGG--AUCGACGGACGUC------UAAAGGGGUUAGCUUUGUCU--CGGCU--GUCUGC----CACCGUUACC-----------GGCGAA---AACAGUACAAUUGCAAACGACAAUCGU---------------------------------------------------GCUCCGGUUGCUCUGGCUGCGUAA---------------------GCAGUU-CGAGUCGAACCGA-------------------CUUUAAGU------------------------CCUAGCGC-CUAG-C-----------------------------------------------------------------------CGCGUUAGGCG--GGGUUC-------------------GCAGGU--ACCU------GGCAACAGAA--ACCUGCACUC****************************************************GUUCC--UUCG--GGAACUAUGGA-CAUAA----------------------ACGCGCUCGUAA-----UAAGCGGAUCGGAC-CCGGGGGCGGUACCCGG-CGGCUCCACCA Rtm1t1
Rhizobiales
Afa1t1      GGGGGCG-----AAAUAGG--AUCGACAAGGGCG------UAAAGAUCG-AACUUUUGCU--CGGC--AUGAUACC----GCCGUUAUC-----------GGGUCA----CAAGUGUAGUUGCAAAUGACAACAAC------------------------------------------------GCUAAGGAAUACGCUCUCGCUGCCUAA--------------------UGGCGGU-GCGGGAAUUCCGCU-------------------CU-AAGU------------------------CCUUACGG-UUAG-C-----------------------------------------------------------------------CCCGUAAGGCG--GGGUUC-------------------GGAGGU--ACCU------GGCAACAGAA--ACCUCCACCU****************************************************GC-CGGGGCAACCCG-GCUAUGGC-GAUAA---------------------ACGGUCGGUGUAA-----UAAACCUAUUGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCA Afa1t1
Atu1t1      GGGGGCG-----AAAUAGG--AUCGACAAGGGCG------UAAAGAUCG-AACUUUUGCU--CGGC--AUGAUACC----GCCGUUAUC-----------GGGUCA----CAAGUGUAGUUGCAAAUGACAACAAC------------------------------------------------GCUAAGGAAUGCGCUCUCGCUGCCUAA--------------------UGGCGGU-GCGGGAAUUCCGCU-------------------CU-AAGU------------------------CCUUACGG-UUAG-C-----------------------------------------------------------------------CCCGUAAGGCG--GGGUUC-------------------GGAGGU--ACCU------GGCAACAGAA--ACCUCCACCU****************************************************GC-CGGGGCAACCCG-GCUAUGGC-GAUAA---------------------ACGGUCGGUGUAA-----UAAACCUAUUGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCA Atu1t1
Avi1t1      GGGGGCG-----AAAUAGG--AUCGACAAGGGCG------UAAAGAUCG-AACUUUUGCU--CGGC--AUGAUACC----ACCGUCAUC-----------GGGUCA----CAAGUGUAGUUGCAAAUGACAACAAC------------------------------------------------GCUCAGGGUUACGCUGUCGCUGCUUAA--------------------UCGCGGU-GCCAGAAACCCAAA-------------------CU-AAGU------------------------CCUUACGG-GUAG-C-----------------------------------------------------------------------ACCGUAAGGCG--GGGUUC-------------------GGAGGU--ACCU------GGCAACAGAA--ACCUCCACUU****************************************************GCCGGUGCUUGCAUCGGCUAUGGC-AAUAA---------------------ACGGUCGGUGAAA-----UAAACCUAUUGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCA Avi1t1
Rle4t2      GGGGGCG-----AAACAGG--AUCGACAAGGGUG------UAAAGAUCG-UCUUUUUGCU--CGGC--AUUGUACC----GCCGUUAUC-----------GGGCUA----AAAUUGUAGUUGCAAACGACAACUAU---------------------------------------------------GCGGAAGCUCGUCUCGCUGCUUAA--------------------UCGCGGU-GUGACACUUCAAU--------------------CA-AAGU------------------------CCUAGUGG-UUCG-C-----------------------------------------------------------------------ACCUCUAGGCG--GGGUCC-------------------GAAGGC--ACCU------GGCAACAGAA--GCCUUCACCU****************************************************GCCGGCUUUCGGGUCGGCUAUGGC-GAUAA---------------------AUGAGCGGUGUAA-----UAAACCUAUUGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCA Rle4t2
Sme10t24    GGGGGCG-----AAAUAGG--AUCGACAAGGGCG------UAAAGAUCG-ACUUUUUGCU--CGGC--AUUGUACC----ACCGUUAUC-----------GGGCUA----AACUUAUAGUUGCAAACGACAACUAU---------------------------------------------------GCUGAAGCACGUCUCGCUGCCUAA--------------------CGGCGGU-GCGACACUUCAAAUC---------------------AAGU------------------------CCUUCCGGG-UAG-C-----------------------------------------------------------------------ACCGUAAGGCG--GGGUCC-------------------GAAGGC--ACCU------GGCAACAGAA--GCCUUCACCU****************************************************GC-CGUCUUCGGGCG-GCUAUGGC-AAUAA---------------------ACGGGCGAUGCAA-----UAAACCCAUUGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCA Sme10t24
Mlo1t3      GGGGGCG-----AAAUAGG--AUCGACGAAGGUG------UAAAGAUCGUACUU-UUGCC--CGGC--AUUGUACC----ACCGUCAUC-----------GGGCUA----AACUUAUAGUUGCCAACGACAACUAU---------------------------------------------------GCGGAAGCACGUCUCGCUGCUUAA---------------------UGCAGU-GCGAUAGCUUCAAAUC--------------------AAGC------------------------CCUAGGGGU-UCG-C-----------------------------------------------------------------------ACUUCUAGGCG--GGGUUC-------------------GGAGGU--ACCU------GGCAACAGAA--ACCUCCACUU****************************************************GU-CGGCUUGA-CCG-ACUAUGGC-GAUAA---------------------AUGGGCGAUGAAA-----UAAGCCGUUCGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCA Mlo1t3
Cbn1t2      GGGGGCG-----AAAUAGG--AUCGACGAGGGUG------UAAAGAUCGGACUU-UCGCU--CGGC--AUGGUACC----ACCGUUAUC-----------GGACCG---AACCUUAUAGUUGCCAACGACAACUAU---------------------------------------------------GCGGAAGCACGUCUCGCUGCUUAA---------------------UGCAGC-GCGAUAGCUUCAAUUC--------------------AAGU------------------------CUCAGGCCG-UCG-C-----------------------------------------------------------------------AGGCCUGAGCG--GGGUUC-------------------GGAGGC--ACCU------GGCAACAGAA--GCCUCCACUU****************************************************GU-CGGUUUCGGCCG-ACUAUGGC-GAUAA---------------------ACGGACGAUGCAA-----UAAGCCAUUCGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCA Cbn1t2
Bhe2t2      GGGGGCG-----AAACAGG--AUCGACAAAAGUG------UAAAGAUUG-CUCUUUUACU--CGGU--AUAGUACC----ACCGUUAUC-----------GGACUA----AAUGAGUAGUUGCAAAUGACAACUAU---------------------------------------------------GCGGAAGCACGUCUCGCUGCCUGA--------------------GGUGGUG-UGAAUGCUUCAAACU---------------------AAGU------------------------CUUAAACCG-UCG-C-----------------------------------------------------------------------AGGUUUAAGCG--GGGUUC-------------------GAAGGC--ACCU------GGCAACAGAA--GCCUUCACUU****************************************************GC-UGG-CUUG-CCA-GCUAUGGU-AAUAA---------------------AUGGACAAUGAAA-----UAAGCUUAUUGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCA Bhe2t2
Bqu3t2      GGGGGCG-----AAAUAGG--AUCGACAAGGGUG------UAAAGAUUG-CUCUUUUACU--CGGC--AUAGUACC----ACCGUCAUC-----------GGACUA----AAUGAGUAGUUGCAAAUGACAACUAU---------------------------------------------------GCGGAAGCACGUCUCGCUGCUUAA--------------------UGUAGUG-UGAAUGUUUCAAACU---------------------AAGC------------------------CUUAAAUCG-UCG-C-----------------------------------------------------------------------AGAUUUAAGCG--GGGUUC-------------------GAAGGC--ACCU------GGCAACAGAA--GCCUUCACUU****************************************************GC-UGG-CUUA-CCA-GCUAUGGU-AAUAA---------------------AUGGACAAUGAAA-----UAAACUCAUUGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCA Bqu3t2
Bab60t169   GGGGGCG-----AAACAGG--AUCGACAAGGGUG------UAAAGAUCG-CUCUUUUACU--CGGC--AUGAUACC----ACCGUUAUC-----------GGGUCA----ACAGAGUAGUUGCAAAUGACAACAAU------------------------------------------------GCUCAGGGUUAUGCUCUCGCUGCCUAA--------------------UGGCGGU-GCGGGAAACCCACU-------------------CUAAAGU------------------------CCUUAGGG-UUAG-C-----------------------------------------------------------------------CCCUUAAGGCG--GGGUUC-------------------GGAGGC--ACCU------GGCAACAGAA--GCCUCCACUU****************************************************GU-CGGCGCAAGCCG-ACUAUGGU-GAUAA---------------------ACGGACGGUGUAA-----UAAACCCAUUGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCA Bab60t169
Bme16t65    GGGGGCG-----AAACAGG--AUCGACAAGGGUG------UAAAGAUCG-CUCUUUUACU--CGGC--AUGAUACC----ACCGUUAUC-----------GGGUCA----ACAGAGUAGUUGCAAAUGACAACAAU------------------------------------------------GCUCAGGGUUAUGCUCUCGCUGCCUAA--------------------UGGCGGU-GCGGGAAACCCACU-------------------CUAAAGU------------------------CCUUAGGG-UUAG-C-----------------------------------------------------------------------CCCUUAAGGCG--GGGUUC-------------------GGAGGC--ACCU------GGCAACAGAA--GCCUCCACUU****************************************************GU-CGGCGCAAGCCG-ACUAUGGU-GAUAA---------------------ACGGACGGUGUAA-----UAAACCCAUUGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCA Bme16t65
Bab60t169   GGGGGCG-----AAACAGG--AUCGACAAGGGUG------UAAAGAUCG-CUCUUUUACU--CGGC--AUGAUACC----ACCGUUAUC-----------GGGUCA----ACAGAGUAGUUGCAAAUGACAACAAU------------------------------------------------GCUCAGGGUUAUGCUCUCGCUGCCUAA--------------------UGGCGGU-GCGGGAAACCCACU-------------------CUAAAGU------------------------CCUUAGGG-UUAG-C-----------------------------------------------------------------------CCCUUAAGGCG--GGGUUC-------------------GGAGGC--ACCU------GGCAACAGAA--GCCUCCACUU****************************************************GU-CGGCGCAAGCCG-ACUAUGGU-GAUAA---------------------ACGGACGGUGUAA-----UAAACCCAUUGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCA Bab60t169
Rpa4t3      GGGGGCG-----AAAUAGG--AUCGACGAGGGCG------UAAAGGGCU-CGCUUUUUCC--CGGU--AUUGUUCC----GCCGUUAUC-----------GGGCUA----CUGCAAUAGUUGCCAACGACAACUAU---------------------------------------------------GCUCCGGUUGCUCAGGCUGCGUAA--------------------CGCAGUU-UGAAA-GACCAC--------------------UUUAAAGC------------------------CCUAACGGGUUAAGC-----------------------------------------------------------------------UCCGUUAGGCG--GGGUUC-------------------GGAGGC--ACCU------GGCAACAGAA--GCCUCCACUC****************************************************GU-CGGGGCAACCCG-ACUAUGGA-AAUAA---------------------AUGGCCGCCGCAA-----UAAACCAUUCGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCc Rpa4t3
Rpa6t1      GGGGGCG-----AAACAGG--AUCGACGAGGGCG------UAAAGGGCU-UGCUUUUUCC--CGGU--AUUGUUCC----GCCGUUAUC-----------GGGCUA-----UGCAAUAGUUGCCAACGACAACUAU---------------------------------------------------GCUCCGGUUGCUCAGGCUGCGUAA--------------------CGCAGUU-UGAAA-GACCAA-------------------GUCUGAAGU------------------------CCUGACGGGUUAAGC-----------------------------------------------------------------------UCCGUUUGGCG--GGGUUC-------------------GGAGGC--ACCU------GGCAACAGAA--GCCUCCACUU****************************************************GUCGGG-GCAA-CCCGACUAUGGA-AAUAA---------------------AUGGCCGUCGUAA-----UAAACCAUUCGGAC-CCGGGGGCAGUACCCGG-CGCCUCCACCc Rpa6t1
Rpa3t1      GGGGGCG-----AAACAGG--AUCGACGAGGGCG------UAAAGGGCG-AGCUUUUGUC--CGGA--AUGGUUCC----GCCGUGAUC-----------GGGCCA-----UGCAAUAGUUGCCAACGACAACUAU---------------------------------------------------GCUCCGGUUGCUCAGGCAGCGUAA--------------------CGCUGCU-UGAAA-GACCAC--------------------AUGAAAGU------------------------CCUGGCGGGUUAAGC-----------------------------------------------------------------------GCCGCCAGGCG--GGGUUC-------------------GGAGGC--GCCU------GGCAACAGAA--GCCUCCACUG****************************************************GCCAG--UGCG--CUGGCUAUGAC-AAUAA---------------------ACCGCCGUCGCAA-----UAAACCAUUCGGAC-CCGGGGGCAGUACCCGG-CGCCUCCACCA Rpa3t1
Rpa3t2      GGGGGCG-----AAACAGG--AUCGAUGGCCGCGA-----AGAAGUGUU-GAAUUGUUCC--CGGC--AUGAUACC----GCCGUUAUC-----------GGGUCA-----AAACCUAAAUGCAAACGAUAACGUU---------------------------------------------CGCAUGAACGAAGUGCGCCUCGCGGCGUAA--------------------------------CCGUUCG--------------------------------------------------------------------------------------------------------------------------------------------------------GGGUA----------------------GGUCC-ACCU------AGCAACAGAACGG-CC--AUGG****************************************************GUC----GCAA----GACGAUGGC-GCUGA---------------------AACUCAACGCGG-------ACUGCGGGCAGAC-CCGGGGGCAGUACCCGG-CGCCUCCACCc Rpa3t2
Rpa2t1      GGGGGCG-----AAAUAGG--AUCGACGAGGGCG------UAAAGGGCU-UGCUUUUUCU--CGGU--AUUGUUCC----GCCGUUAUC-----------GGGCUA----AUGCAAUAGUUGCCAACGACAACUAU---------------------------------------------------GCUCCGGUUGCUCAGGCUGCGUAA--------------------CGCGGUU-UGAAA-GACCAAG-------------------UCUAAAGU------------------------CCUAACGGGUUAAGC-----------------------------------------------------------------------UCCGUUAGGCG--GGGUUC-------------------GGAGGC--ACCU------GGCAACAGAA--GCCUCCACUU****************************************************GU-CGGGGCAACCCG-ACUAUGGA-AAUAA---------------------AUGGCCGUCGUAA-----UAAACCAUUCGGAC-CCGGGGGCAGUACCCGG-CGCCUCCACCA Rpa2t1
Bja1t3      GGGGGCG-----AAAUAGG--AUCGACGAGGGCG------UAAAGGGCG-UGCUUUUUCC--CGGU--AUUGUUCC----GCCGUUAUC-----------GGGCUA----CUGCAAUAGUUGCCAACGACAACUUU---------------------------------------------------GCUCCGGUUGCUCAGGCUGCGUAA--------------------CGCAGUU-UGAAA-GACCAU--------------------CUUAAAGU------------------------CCUAACGGGUUAAGC-----------------------------------------------------------------------UCCGUUAGGCG--GGGUUC-------------------GGAGGC--ACCU------GGCAACAGAA--GCCUCCACUU****************************************************GC-CGG-UUCG-CCG-GCUAUGGA-AAUAA---------------------ACGGUCGUCGUAA-----UAAACCAUUCGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCA Bja1t3
Nha1t1      GGGGGCG-----AAACAGG--AUCGACGAGGGCG------UAAAGGGCU-CGCUUUUUCU--CGGU--AUGGUUCC----GCCGUUAUC-----------GGGCUA-----UGCAAUAGUUGCAAACGACAACUAU---------------------------------------------------GCUCCGGUUGCUCAGGCUGCGUAA--------------------CGCAGUU-UGAAA-GACCAU--------------------UCUGAAGU------------------------CCUGACGGGUUAAGC-----------------------------------------------------------------------UCCGUCAGGCG--GGGUUC-------------------GGAGGC--ACCU------GGCAACAGAA--GCCUCCACUC****************************************************GC-CGG-UUCG-CCG-GCUAUGGA-AAUAA---------------------ACGGCCGUCGUAA-----UAAACCAUUCGGAC-CCGGGGGCAGUACCCGG-CGCCUCCACCA Nha1t1
Nwi1t1      GGGGGCG-----AAACAGG--AUCGACGAGGGCG------UAAAGGGCU-CGCUUUUUCC--CGGU--AUGGUUCC----GCCGUUAUC-----------GGGCUA-----UGCAAUAGUUGCAAACGACAACUAU---------------------------------------------------GCUCCGGUUGCUCAGGCUGCGUAA--------------------CGCAGUU-UGAAA-GACCAC--------------------UCUGAAGC------------------------CCUGACGGGUUAAGC-----------------------------------------------------------------------UCCGUCAGGCG--GGGUCC-------------------GGAGGC--ACCU------GGCAACAGAA--GCCUCCACUU****************************************************GC-CGG-UUCG-CCG-GCUAUGGA-AAUAA---------------------AUGGCCGCCGCAA-----UAAACCAUUCGGAC-CCGGGGGCAGUACCCGG-CGCCUCCACCA Nwi1t1
Mex5t4      GGGGGCG-----AAAUAGG--AUCGACGAGGGCG------UAAAGGGUG-AACUUUCGCU--CGGC--AUGGUUCC----GCCGUUAUC-----------GGGCCU----UUGCAAUAGUUGCCAACGACAACUUU---------------------------------------------------GCUCCGGUGGCUGUCGCCGCGUAA---------------------GCGGUG-CCAAAAACCGAC---------------------CUAAAGU------------------------CCUAGCGG-GUAG-C----------------------------------------------------------------------ACCGCAUAGGCG--GGGUUC-------------------GGAGGU--ACCU------GGCAACAGAA--ACCUCCACUC****************************************************GCCGGUCGCAAGGCCGGCUAUGGC-GAUAA---------------------ACGUUCUUCGAAA-----UAAACCUAUCGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCc Mex5t4
Rhodospirillales
Mma3t1      GGGGGCG-----AAAUAGG--AUCGACGAGGGCG------UAAAGGGGG-AGCUUUCGCU--CGGC--AUGGUUCC----GCCGUUAUC-----------GGGCCU----UUGCAAUAGUUGCCAACGACAACUUU---------------------------------------------------GCUCCGGUGGCUGUCGCCGCGUAA---------------------GCGGUG-CCAAAAACCGAC---------------------CUAAAGU------------------------CCUAGCGG-GUAG-C----------------------------------------------------------------------ACCGCAUAGGCG--GGGUUC-------------------GGAGGU--ACCU------GGCAACAGAA--ACCUCCACUC****************************************************GCCGGUCGCAAGGCCGGCUAUGGC-GAUAA---------------------ACGUUCUUCGCAA-----UAAACCUAUCGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCA Mma3t1
Mma3t2      GGGGGCG-----AAAUAGG--AUCGACGUGCGCAG-----UAAAGGUCU-GGUUUGCGUU--CGGC--AUGAUACC----ACCGUUAUC-----------GGGUCA---AUCCUAACAAGUGCCAACGACAACGUU------------------------------------------------------GAACUUGCCGCUGCGGCUUAG-----------------------------UCCGUAAGCG--------------------------------------------------------------------------------------------------------------------------------------------------------CGGUCC-------------------GGGGGGA-ACCG------GGCAACAGAACUCCCCCCACUU****************************************************G-CCGG-GCAA-CCGG-CUAUGAC-GCUAA---------------------ACGCCACACGGAA-----UAGACGUUACGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCA Mma3t2
Bme16t2     GGGGGCG-----AAAUAGG--AUCGACACGCGUGG-----UAAAGAUAA-AGGUUGUGUU--CGGC--AUGGUAUCC---ACCGUUAUC-----------GGGCCA---ACUCUGACAAGUGCCAACGACAACGUU------------------------------------------------------GAACUUGCCGCUGCGGCCUAA---------------------------ACACCCGUAAGCG-------------------------------------------------------------------------------------------------------------------------------------------------------CGGUUC-------------------GGGGGGGCACCG------GGCAACAGAAGCCCCCCCACUU****************************************************GC-CGGCUUGU-CCG-GCUAUGAC-GCUAA---------------------ACCCUUUAUGGAA-----UAAGCGUUGUGGAC-CCGGGGGCGGUACCCGG-CGCCUCCACCA Bme16t2
Bam1t1      GGGGACG-----AAACAGG--CUCGACACGCAUGG-----UAAAGACUU-AUCUUUUGCC--CGGC--AUUGUACC----ACCGUCAUC-----------GGGCUA----AACUUACAAGUGCCAACGAUAACUCA---------------------------------------------------GAGGUGCUCGCUGUCGCUGCAUAA------------------------------GCGAUAAGCG-------------------------------------------------------------------------------------------------------------------------------------------------------CGGUUC-------------------GGGAGGGCACCG------GGCAACAGAAGCCCUCCCACCU**************************************************GCAAGGGGUUCGUCCCCGGCUAUGGC-GAUAA---------------------ACGGUAAGUGAAA-----UAAGUGUUGUGGAC-CCGGGGGCAGUGCCCGG-CGUCUCCACCA Bam1t1
Sphingomonadales
Nar2t1      GGGGCCG-----AACUAGG--AUCGACGUGUGUUG-----AAAAGCGUU-GUU-UUCACC--CGGG--CUGAGUAA----CCCGUUCAA-----------GGCUCA---AAACUCACAAGUGCCAACGACAACGAA------------------------------------------------------GCACUUGCUCUCGCGGCGUAA-----------UUCUAGGGGCUAACGCCCUGAAGUUACUAAGUUAGAGCA---------------------------------------------------------------------------------------------------------------------------------------------CGGUUC-------------------GGACCGA-ACCG------GGUAACAGAA-UCGGAAACCGG****************************************************GC-CGGUUCAGGCCG-GCUAUGGU-GAUAA---------------------ACUGCGGCGUGCA----AUAGGCACAGCGGAC-CCGGGGGCGGUACCCGG-CGGCUCCACCA Nar2t1
Sal1t2      GGGGCCG-----AACCAGG--AUCGACGUGUGUUC-----AAAGACGAU-GCU-UUCUUC--CGGG--CUGAGUAA----CCCGUUAAA-----------GGCUCA---AAACCAAUAAGUGCUAACGAUAACGAA------------------------------------------------------GCACUCGCUCUUGCUGCCUGA-----------CCGAUAAGCCUCACGGCCUAAGGUUAGACAAAUAGAACG---------------------------------------------------------------------------------------------------------------------------------------------CGGUUC-------------------GGACCGA-ACCG------GGCAACAGAA-UCGGAAACCAG****************************************************GU-CGGCUUCGGCCG-ACUAUGAG-GAUAA---------------------AUGGUGUCGUGGA----AUAGACACAGCGGAC-CCGGGGGCAGUACCCGG-CGGCUCCACCA Sal1t2
Eli2t1      GGGGCCG-----AACCAGG--AUCGACGUGUGUUG-----AAAGGCAUU-GUU-UUCACC--CGGG--CUGAGUAU----CCCGCAAAA----------CUGUUCA---AAACACACAAGUGCCAACGAUAACGAA------------------------------------------------------GCACUCGCUCUCGCAGCGUAA-----------CAUGACGGCCUAACGGCCUAACGUUACAAAGCUAAAGCG---------------------------------------------------------------------------------------------------------------------------------------------CGGUU--------------------GGACC-C-ACCG------GGCAACAGAAGCGGAUUCCGGG****************************************************GU-CCGUUUCGGCGG-GCUAUGGU-GAUAA---------------------ACUGCGGUGUGUA----AUAGACGCAACGGAC-CCGGGGGCAGUACCCGG-CGGCUCCACCA Eli2t1
Zmo4t7      GGGGGCG-----AAACAGG--AUCGACGUGUGUAG-----UAAAGACUU-GAUUGCCAUC--CGGC--GUGAUUGA----GCCGUUAAA----------CCGAUCA----UUUUUAUAAGUGCCAACGAUAACGAG------------------------------------------------------GUACUCGCUGUUGCUGCGUAA------------UGGAAACCUUCACGGGUAGACAUUACUAAGUAAGAGCG---------------------------------------------------------------------------------------------------------------------------------------------CGGUU--------------------GGGCUGC-ACCG------GGCAACAGAAGCAGAUUCCAGC****************************************************GUCAC--UUCG--GUGACUACGAU-GGUAG---------------------ACUGUUAAGUGAA----AUAGACUCGACGGACCCGGAGGGCAGUACUCCGGCGCCUCCACCA Zmo4t7
Sel1t1      GGGGCCG-----AACCAGG--AUCGACGUGUAUUG-----AAAAGCGCU-GUC-UUCGCU--CGGA--AUGGGACC----ACCGCAAC------------GGCCCA-----UUACACAAGUGCCAACGAUAACGAA------------------------------------------------------GCACUCGCUAUUGCGGCGUAA------------CCUCACGGCUUAACGGCCUAAGGUUAUUCUAAAAUGCG---------------------------------------------------------------------------------------------------------------------------------------------CGGUU--------------------GGGCCAC-ACCG------GGCAACAGAAGUGGACUCCAGC****************************************************GCCGGG-UUCG-CCCGGCUAUGGC-GAUAA---------------------ACAAUGGCGUAUA----AUAGAUGCAGCGGAC-CCGGGGGCAGUACCCGG-CGGCUCCACCA Sel1t1
Rickettsiales
Ech1t1      GGGGAUG-----AAACAGG--AUCGACAUGCAUAG-----UAAAGGGGAUAGUUUUUGCU--CGG----UGAGAAAACA-GCCGUUUAA----------AUGCUCA---AAAUUUAUAAGUGCAAACGAUAAUUUC---------------------------GUUUUUGCUAAUGAUAAUAAUAGCAGUGCUAACUUAGUAGCUGCUUAG------------------------------UUUUAUUAUUAGCG---------------------------------------------------------------------------------------------------------------------------------------------------CGGUUUUUUU--------------AAGGGUUUU-CCG------GGCAACAGAAAAACCCUUUUUU****************************************************GUGCU--UUU---AGCACUAUGGC-AAUAA---------------------AGGCAUCUUAAAA-----UAGAUGUAUUGGAC-CCGAGGGCAGUGCUCGG-CAUCUCCACuu Ech1t1
Eru2t1      GGGGAUG-----AAACAGG--CUCGACAUGCAUAG-----UAAAGGGGAUAGCUUUUGCU--CGG----UGAGAAAACA-GCCGUUUCA---------AGUGAUCA---AAACUUAUAAGUGCAAACGAUAAUUUC---------------------------GUUUCUGCUAAUGAUAAUAAUAGCACUGCUAACUUAGUAGCUGCUUAG------------------------------UUUUAAAAUUAGCA---------------------------------------------------------------------------------------------------------------------------------------------------CGGUUUUUU----------------GGGGUUUU-CCG------GGUAACAGAAAAACCCC-UCAC****************************************************GUGCU--UUU----GCACUAUGGC-AAUAA---------------------AUGCAUCUUAGAA-----UAAAUGUAUUGGAC-CCGAGGGCAGUGCUCGG-CAUCUCCACug Eru2t1
Eru1t2      GGGGAUG-----AAACAGG--CUCGACAUGCAUAG-----UAAAGGGGAUAGCUUUUGCU--CGG----UGAGAAAACA-GCCGUUUCA---------AGUGAUCA---AAACUUAUAAGUGCAAACGAUAAUUUC---------------------------GUUUCCGCUAAUGAUAAUAAUAGCACUGCUAACUUAGUAGCUGCUUAG------------------------------UUUUAUAAUUAGCA---------------------------------------------------------------------------------------------------------------------------------------------------CGGUUUUUU----------------GGGGUUUU-CCG------GGUAACAGAAAAACCCC-UCCC****************************************************GUGCU--UUU----GCACUAUGGC-AAUAA---------------------AUGCAUCUUAGAA-----UAAAUGUAUUGGAC-CCGAGGGCAGUGCUCGG-CAUCUCCACug Eru1t2
Eca1t1      GGGGGUG-----AAACAGG--AUCGACAUGCAUAG-----UAAAGGGGAUAGUUUUUGCC--CGG----UGAGAAAGCA-GCCGUUUAA----------AUGCUCA---AAAUUUAUAAGUGCAAACGAUAAUUUC------------------------GUUUUUGCAAAUGACAAUAAUAGCAGUGUUGCUGGCUUAGUGGCUGCUUAG------------------------------UUUUGUCAUUAGCG---------------------------------------------------------------------------------------------------------------------------------------------------CGGUUUUUUA--------------GAGGGUUUC-CCG------GGCAACAGAAAAAUCCUCUUUU****************************************************GUGUU--UUA---AGCACUAUGGC-AAUAA---------------------AGGCAUCUUAAAA-----UAGAUGUAUUGGAC-CCGAGGGCAGUGCUCGG-CAUCUCCACuu Eca1t1
Aph5t6      GGGGAUG-----AGACAGG--UUAGACAGGCGUAG-----UAAAGAAGCUGGCUGUUGCU--CGGU--GGGAAUUCCA--GCCGUAUAA----------UUGGGUC---AUAUUUAUAAGUGCAAACGAUGAUUUC---------------------------GUUGCCGCUAAUGACAACGUGGAAACAGCUUUCGUAGCUGCAGCCUAG------------------------------UGUGCCU-UUAGCG---------------------------------------------------------------------------------------------------------------------------------------------------CGGUCUC------------------GGAGGCUUACCG------GGCAACAGAAAAGCCUCCAUUU****************************************************GUGA---UCUU---UCACUAUGGC-AAUAA---------------------AAGUUACUUGGAA-----UAGACGUUUUGGAC-CCGAGGGCAGUGCUCGG-CAUCUCCACgu Aph5t6
Ama20t10    GGGGAUG-----AAACAGG--AUAGACAGACGCAA-----UAAAGAGGACGGCGUUUGCU--CGGU--GGGAAUUCCA--GCCGUAUAA----------GUGGGUC---AUUUUUAUAAGUGCAAACGAUGAUUUC---------------------------GUUGCCGCUAAUGAUAACAUGGAAACAGCUUUCGUAGCUGCUGCCUAG-----------------------------UUUUUGUCUUUAGCG---------------------------------------------------------------------------------------------------------------------------------------------------CGGUUUU------------------GGGGGCUUACCG------GGCAACAGAAAAGCCCCCGCCA****************************************************GUG----GUUU----CACUAUGGC-AAUAA---------------------AGGCCUCUUGGAA-----UAGGCGUUUUGGAC-CCGAGGGCAGUGCUCGG-CAUCUCCACug Ama20t10
Nse1t1      GGGGGUG-----AUUUAGU--UUCGACAGGUAU-------UAAAGGCUA-AACUUUUGUU--CGGU--UGAGUGAU----CCCGUGAU----------UCACAACA---CUUUUUAUAAGUGCAAACGACAAUUUU---------------------------------------GAAGCUGGUUCUGCUGAAUAUGCAGUAGCUGCCUAG------------------------------UUUAUAGGUAGUACAGCG-----------------------------------------------------------------------------------------------------------------------------------------------CGGUUU--------------------GGGGCG-GCCG------GUCAACAGAAC-UGCCCCAGUU****************************************************GCGC--UGUUUU--GCGCUAUGAC-AAUAA--------------------AUGGUUUUUCGUAA-----UAGGUAUCUUGGAC-CCGAAGGCGGAGUUCGG-CACCUCCACCg Nse1t1
Wen5t1      GGGGACG-----AAUAAGG--AUCGACAUGCAUAG-----UAAAGAUGG-UAGCUUUGCU--CGGU--UAGACACC----ACCGCUAAG-----------AGUUCA-----UAAUUUAAAUGCAAACGAUAAUUUU---------------------------------------GCUGCUGAAGACAAUGUCGACGCAAUAGCUGCUUAA--------------------UUUAAGCACUAUAACUUCAUUGCUAUAAGCA--------------------------------------------------------------------------------------------------------------------------------------------CGGUUC-------------------AGGGAAC-GCCG------GGUAACAGAA-GUUCCCCAAAA****************************************************GUACAU-UUU--GUGUACUAUAGC-AAUAA---------------------AAUUACCUUGUAA-----UAGGUGUAUUGGAC-CCGAGGGCAGUACUCGG-CGUCUCCACCA Wen5t1
Wen9t2      GGGGGCG-----AAUAAGA--AUCGACAUGCAUAG-----UAAAGAUGG-UAACUUUGCU--CGGU--UAGAUACC----ACCGCUAAG-----------AGUUCA-----UAGUUUAAACGCAAACGAUAAUUUU---------------------------------------GCUGCUGAAGGUGAUGUU---GCGGUAGCUGCUUAA--------------------UUUAAGCACUAUAACUUCAUUACUAUAAGCA--------------------------------------------------------------------------------------------------------------------------------------------CGGCUU-------------------AGGGAAC-GCCG------GGUAACAGAA-GUUCCCCCCAG****************************************************GUGUAU-UUU--AUACACUAUGGC-AAUAA---------------------AAUUACCUUGUAA-----UAGGUGUAUUGGAC-CCGAGGGCAGUACUCGG-CGCCUCCACCA Wen9t2
Wen3t4      GGGGGCG-----AGUAAGG--AUCGACAUGCAUAG-----UAAAGAUGG-UAGCUUUGCU--CGGU--UAGAUACC----ACCGCUAAG-----------AGUUCA-----CAAUUUAGAUGCAAACGAUAACUUU---------------------------------------GCUGCUGAAGACAAUGUU---GCAUUAGCUGCUUAA--------------------UUUAGGCACUAUAACUUCAUCGCUAUAAGCA--------------------------------------------------------------------------------------------------------------------------------------------CGGUUU-------------------AGGGAAC-GCCG------GGUAACAGAA-GUUCCCCCAAA****************************************************GUGUAUUUUUU-AUACACUAUGGC-AAUAA---------------------AAUUACCUUGUAA-----UAGGUGUAUUGGAC-CCGAGGGCAGUACUCGG-CGCCUCCACCA Wen3t4
Wen6t4      GGGGGCG-----AUUAAGG--AUCGACAUGCAUAG-----UAAAGAUGG-UAGCUUUGCU--CGGU--UAGACACC----ACCGCUAAG-----------AGUUCA-----UAAUUUAAAUGCAAACGAUAAUUUU---------------------------------------GCUGCUGAAGAAUAU------CGUGUUGCUGCUUAA--------------------UUUA-GCACAACCGGUUUAUUACUA-AAGCA--------------------------------------------------------------------------------------------------------------------------------------------CGGUUU-------------------AGGGAAC-GCCG------GGUAACAGAA-GUUCCCCCAAA****************************************************GUACAU-UUU--GUGUACUAUAGC-AAUAA---------------------AAUUACCUUGUAA-----UAGGUGUAUUGGAC-CCGAGGGCAGUACUCGG-CGCCUCCACCA Wen6t4
Rpr8t12     GGGGGCG-----AAAUAGG--AUCGACGUGCCUAA-----UAAAAAAGU-UGCUUUUACU--CGGU--AUGAUUCC----ACCGGUGGUUUUUGCCAUAUGGAUCA---AAACAAAGAAACGCAAACGAUAAUCGU------------------------------------------UAUGUAGGUGUUCCAGCUUUAGCUGCAGCUUAA------------------------------GCCUACG----------------------------------------------------------------------------------------------------------------------------------------------------------CGGCUG-------------------GGGAUUU-GCCG------GGCAACAGAAAAA-UCCCAUAC****************************************************GC-UA--AUA---UA-GCUAUAGU-AAUAA---------------------ACGUAAUUUAGAA-----UAGAGGUUGCGGAC-UCGGGGGCAGUACCCGA-CGCCUCCACCA Rpr8t12
Rty3t3      GGGGGCG-----AAAUAGG--AUCGACGUGCCUAA-----UAAAAAAAU-UGCUUUUACU--CGGU--AUGAUCCC----ACCGAUGGCUUUUGCCAUAUGGGUCA---AAACAAAGAAACGCAAACGAUAAUAAG---------------------------------------CGUUAUGUAGGUGUUGCCGCUUUAGCUGCAGCUUAA------------------------------UCCUACG----------------------------------------------------------------------------------------------------------------------------------------------------------CGGCUU-------------------GGGAUUU-GCCG------GGCAACAGAAAAA-UCCCAUGC****************************************************GC-UA--AUA---UA-GCUAUAGU-AAUAA---------------------ACGUAAUUUAGAA-----UAGAGGUUGCGGAC-UCGGGGGCAGUACCCGA-CGCCUCCACCA Rty3t3
Rak2t1      GGGGGCG-----AAAUAGG--AUCGACGUGCCUAA-----UAAAAAGAU-UGCUUUUACU--CGGG--AUGAUUCC----GCCGAUGGCUUUUGCCAUAUGGGUCA---AAACAAAGAAACGCAAACGAUAAUAAU---------------------------------------CGUUCUGUAGAU---UUAGCUCUA---GCAGCUUAA------------------------------UCCUACG----------------------------------------------------------------------------------------------------------------------------------------------------------CGGCUG-------------------GGGGUUU-GCCG------GGCAACAGAAAAA-CCCCACAC****************************************************GC-UA--AUA---UA-GCUAUAGU-AAUAA---------------------ACGUAAUUUAGAA-----UAGAGGUUGCGGAC-UCGGGGGCAGUACCCGA-CGCCUCCACCA Rak2t1
Rfe2t1      GGGGGCG-----AAAUAGG--AUCGACGUACCUAA-----UAAAAAGAU-UGCUUUUACU--CGGG--AUGAUUCC----GCCGAUGGCUUU-GCCAUAUGGGUCA---AAACAAAGAAACGCAAACGAUAAUAAU---------------------------------------CGUUAUGUAGGU---GCAGCUUUA---GCAGCUUAA------------------------------UCCUACG----------------------------------------------------------------------------------------------------------------------------------------------------------CGGCUG-------------------GGGGUUU-GCCG------GGCAACAGAAAAA-CCCCACAU****************************************************GC-UA--AUA---UA-GCUAUAGU-AAUAA---------------------ACGUAAUUUAGAA-----UAGAGGUUGCGGAC-UCGGGGGCAGUACCCGA-CGCCUCCACCA Rfe2t1
Rri1t7      GGGGGCG-----AAAUAGG--AUCGACGUGCCUAA-----UAAAAAGAU-UGCUUUUACU--CGGG--AUGAUUCC----GCCGAUGGCUUGUGCCAUAUGGGUCA---AAACAAAGAAACGCAAACGAUAAUAAU---------------------------------------CGUUCUGUAGGUCGUUUAGCUUUA---GCAGCUUAA------------------------------UCCUACG----------------------------------------------------------------------------------------------------------------------------------------------------------CGGCUG------------------GAGGGUGU-GCCG------GGCAACAGAAAAACCCUCACUU****************************************************GC-UA--AUA---UA-GCUAUAGU-AAUAA---------------------ACGUAAUUUAGAA-----UAGAGGUUGCGGAC-UCGGGGGCAGUACCCGA-CGCCUCCACCA Rri1t7
Rco1t3      GGGGGCG-----AAAUAGG--AUCGACGUGCCUAA-----UAAAAAGAU-UGCUUUUACU--CGGG--AUGAUUCC----GCCGAUGGCUUGUGCCAUAUGGGUCA---AAACAAAGAAACGCAAACGAUAAUAAU------------------------------------------CGUUCUGUAGGUCAUUUAGCUUUAGCAGCUUAA------------------------------UCCUACG----------------------------------------------------------------------------------------------------------------------------------------------------------CGGCUG-------------------GAGGGUGUGCCG------GGCAACAGAACAACCCUCACUU****************************************************GC-UA--AUA---UA-GCUAUAGU-AAUAA---------------------ACGUAAUUUAGAA-----UAGAGGUUGCGGAC-UCGGGGGCAGUACCCGA-CGCCUCCACCA Rco1t3
Rsi1t2      GGGGGCG-----AAAUAGG--AUCGACGUGCCUAA-----UAAAAAGAU-UGCUUUUACU--CGGG--AUGAUUCC----GCCGAUGGCUUGUGCCAUAUGGGUCA---AAACAAAGAAACGCAAACGAUAAUAAU------------------------------------------CGUUCUGUAGGUCAUUUAGCUUUAGCAGCUUAA------------------------------UCCUACG----------------------------------------------------------------------------------------------------------------------------------------------------------CGGCUG-------------------GAGGGUGUGCCG------GGCAACAGAACAACCCUCACUU****************************************************GC-UA--AUA---UA-GCUAUAGU-AAUAA---------------------ACGUAAUUUAGAA-----UAGAGGUUGCGGAC-UCGGGGGCAGUACCCGA-CGCCUCCACCA Rsi1t2
BETA-PROTEOBACTERIA
unclassified Betaproteobacteria
Tpr1t1      GGGGAUG-----ACAGGGA--UUCGACACGGGGC-------AAGGGAUGGGGUGCCAUGC--CGAAC--AGCCCAAC--GUUAG-----------------GGGCA-------CGAAAGGUGCACCAAGUAAUAGG------------------UUCACCAUUGUGGCUAACGAUUGCAUCGACGCGUUAGUCAGAAGAGCAGUGGUAUAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCGAAGGU-ACACUGAGGGACUAGGCUGACGG-UCAUAGUGCGACUGUAAACAAAGCA-UGUUG----------------------UGCACCCCACA------CCUCCCUGCUGGAC-GUGGGUUCAAUUCCCAC-CAUCUCCAggc Tpr1t1
Tpr1t8      NNNNNNN-----NNNNNNN--NNNNNNACGGGGC-------AAGGGAUGGGGUGCCAUGC--CGAGC--AGCCCAAC--GUUAG-----------------GGGCA-------CGAAAGGUGCACCGAGUAAUAGG------------------UUCACCAUGGUGGCUAACGAUAGAACUUUCGCGUUGGUCGGAAGAGCAGCGGUAUAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCGAAGGUUAUACUGAUGGACUAGGCUGACGG-UCAUAGUGCGACUGUAAACAAAGCA-UGUGG---------------------UCGCACCCCACA-----CCCUCCCUGCUGGAC-GUGGNNNNNNNNNNNNN-NNNNNNNNNNN Tpr1t8
Tpr1t5      NNNNNNN-----NNNNNNN--NNNNNNACGGGGU-------AAGGGUUGGGGUGCCAUGC--CGAGC--CGCCCUAC--GUAAA-----------------GGGCA-------CGAACGGUGCACCACGCAAUAGG------------------UUCACCAUGGUGGCUAACGAUAGCAUGUUCGCGUUGGCUGGAAGAGCAGCGGUGUAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAUGACGAC-CCACUGAUGGAAUAGGCGGCCGA-GCACAUGGCGAUAGUAAACGAAGCA-UGUCG----------------------AGCAGUCCACC------CAACCCCGAUGGAC-GUGGNNNNNNNNNNNNN-NNNNNNNNNNN Tpr1t5
Tpr1t6      NNNNNNN-----NNNNNNN--NNNNNNACGGGGC-------AAGGGAUGGGGUGCCAUGC--CGAGC--AGCCCAAC--GUUAG-----------------GGGCA-------CGAAAGGUGCAACGAGUAACAGG------------------UUCGCCAUGGUGGCUAAUGAUUGCCAGUUCGCGUUAGUCGGAAGAGCAGCGGUGUAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCGAAGGU-AUACUGAUGGACUAGGCUGACGG-UCAUAGUGCGACUGUAAACAAAGCA-UGUUG----------------------UGCACCCCCCA----CACCUCCCUGCUGGAC-GUGGNNNNNNNNNNNNN-NNNNNNNNNNN Tpr1t6
Tpr1t7      NNNNNNN-----NNNNNNN--NNNNNNACGGGGC-------AAGGGAUGGGGUGCCAUGC--CGAGC--AGCCCAAC--GUUAG-----------------GGGCA-------CGAAAGGUGCACCAAGAAAUAGG------------------UUCACCAGGGUGACUAACGACAGCAAGUUCGCGUUGGUCGGAAGAGCAGCGGUAUAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCGAAGAU-ACACUGAAGGACUAGGCUGACGGGUCAUAGUGCGACUGUAAACAAAGCA-UGUUG----------------------UGCACCCCACA------CCUCUCCGCUGGAC-GUGGNNNNNNNNNNNNN-NNNNNNNNNNN Tpr1t7
Tpr1t4      NNNNNNN-----NNNNNNN--NNNNNNACGGGGC-------AAGGGAUGGGGUGCCAUGC--CGAGC--AGCCCUAC--GUUAG-----------------GGGCA-------CGAAAGGUGCACCAAGUAAAAGG------------------UUCACCAUGGUGACUAACGACAGCAAGUUCGCGUUGGUCGGAAGAGCAGCGGUAUAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCUAAGAU-ACACUGAAGGACUAGGCUGACGGGUCAUAGUGCGACGGUAAACAAAGCA-UGUUG----------------------UGCACCCCAUC------CCUCUCCGCUGGAA-GUGGNNNNNNNNNNNNN-NNNNNNNNNNN Tpr1t4
Neisseriales
Ngo1t31     NNNNNNN----NNNNNNNN--NNNNNNGGGGGUUGC-----GAAGCAGAUGCGGGCAUAC--CGGGG-UCUCAG-AU--UCCCGUAAAACA----------CUGAA---UUCAA-AUAGUCGCAAACGACGAAACU---------------------------------------------------------UACGCUUUAGCCGCUUAA--------------------------GGCUAGC---------------------------CGUUGCAGCAGUCG-------------------GUCAAUGGGCUGU----GUGGC----------GAAA-------------------------------GCCACCGCAACGUCAUCUUACAUUGACUG--GUUUCCAGCCGG-------------GUUACUUGGCAGGAAAU----AAGACUUAAGGUAAC-UG------GUUUCCA-AAAGGCCUGUUGGUCGGCAUGA-UGGAAAU---AAGAUUUUCAAAUA--GACACAACUAAGUA-UGUAG----------------------AACGCUUUGUAG------AGGACUUUCGGAC-GGGGNNNNNNNNNNNNN-NNNNNNNNNNN Ngo1t31
Ngo7t2      GGGGGCG----ACCUUGGU--UUCGACGGGGGUUGC-----GAAGCAGAUGCGGGCAUAC--CGGGG-UCUCAG-AU--UCCCGUAAAACA----------CUGAA---UUCAA-AUAGUCGCAAACGACGAAACU---------------------------------------------------------UACGCUUUAGCCGCUUAA--------------------------GGCUAGC---------------------------CGUUGCAGCAGUCG-------------------GUCAAUGGGCUGU----GUGGU----------GAAA-------------------------------GCCACCGCAACGUCAUCUUACAUUGACUG--GUUUCCAGCCGG-------------GUUACUUGGCAGGAAAU----AAGACUUAAGGUAAC-UG------GUUUCCA-AAAGGCCUGUUGGUCGGCAUGA-UGGAAAU---AAGAUUUUCAAAUA--GACACAACUAAGUA-UGUAG----------------------AACGCUUUGUAG------AGGACUUUCGGAC-GGGGGUUCGAUUCCCCC-CGCCUCCACCA Ngo7t2
Nla1t2      GGGGGCG----ACCUUGGU--UUCGACGGGGGUUGC-----GAAGCAGAUGCGGGCAUAC--CGGGG-UCUCAG-AU--UCCCGUAAAACA----------CUGAA---UUCAA-AUAGUCGCAAACGACGAAACU---------------------------------------------------------UACGCUUUAGCCGCUUAA--------------------------GGCUAGC---------------------------CGUUGCAGCAGUCG-------------------GUCAAUGGGCUGU----GUGGC----------GAAA-------------------------------GCCACCGCAACGUCAUCUUACAUUGACUG--GUUUCCAGCCGG-------------GUUACUUGGCAGGAAAU----AAGACUUAAGGUAAC-UG------GUUCCCU-AAAGGCCUGUCGGUCGGCAUGA-CGGGGAU---AAGAU-UCCAAAUA--GAUACGACUAAGUA-UGUAG----------------------AACGCUUUGUAG------AGGACUUUCGGAC-GGGGGUUCGAUUCCCCC-CGCCUCCACCA Nla1t2
Nme139t33   GGGGGCG----ACCUUGGU--UUCGACGGGGGUUGC-----GAAGCAGAUGCGGGCAUAC--CGGGG-UCUCAG-AU--UCCCGUAAAACA----------CUGAA---UUCAA-AUAGUCGCAAACGACGAAACU---------------------------------------------------------UACGCUUUAGCCGCUUAA--------------------------GGCUAGC---------------------------CGUUGCAGCAGUCG-------------------GUCAAUGGGCUGU----GUGGC----------GAAA-------------------------------GCCACCGCAACGUCAUCUUACAUUGACUG--GUUUCCUGCCGG-------------GUUAUUUGGCAGGAAAU----GAGAUUUAAGGUAAC-UG------GUUUCCA-AAAGGCCUGUUGGUCGGCAUGA-UGGAAAU---AAGAUUUUCAAAUA--GACACAACUAAGUA-UGUAG----------------------AACGCUUUGUAG------AGGACUUUCGGAC-GGGGGUUCGAUUCCCCC-CGCCUCCACCA Nme139t33
Nme79t45    GGGGGCG----ACCUUGGU--UUCGACGAGGGUUGC-----GAAGCAGAUGCGGGCAUAC--CGGGG-UCUCAG-AU--UCCCGUAAAACA----------CUGAA---UUCAA-AUAGUCGCAAACGACGAAACU---------------------------------------------------------UACGCUUUAGCCGCUUAA--------------------------GGCUAGC---------------------------CGUUGCAGCAGUCG-------------------GUCAAUGGGCUGU----GUGGC----------GAAA-------------------------------GCCACCGCAACGUCAUCUUACAUUGACUG--GUUUCCUACCGG-------------GUUACUUGGCAGGAAAU----AAGACUUAAGGUAAC-UG------GUUUCCA-AAAGGCCUGUUGGUCGGCAUGA-UGGAAAU---AAGAUUUUCAAAUA--GACACAACUAAGUA-UGUAG----------------------AACGCUUUGUAG------AGGACUUUCGGAC-GGGGGUUCGAUUCCCCC-CGCCUCCACCA Nme79t45
Nme64t25    GGGGGCG----ACCUUGGU--UUCGACGGGGGUUGC-----GAAGCAGAUGCGGGCAUAC--CGGGG-UCUCAG-AU--UCCCGUAAAACA----------CUGAA---UUCAA-AUAGUCGCAAACGACGAAACU---------------------------------------------------------UACGCUUUAGCCGCUUAA--------------------------GGCUAGC---------------------------CGUUGCAGCAGUCG-------------------GUCAAUGGGCUGU----GUGGC----------GAAA-------------------------------GCCACCGCAACGUCAUCUUACAUUGACUG--GUUUCCUACCGG-------------GUUACUUGGCAGGAAAU----AAGACUUAAGGUAAC-UG------GUUUCCA-AAAGGCCUGUUGGUCGGCAUGA-UGGAAAU---AAGAUUUUCAAAUA--GACACAACUAAGUA-UGUAG----------------------AACGCUUUGUAG------AGGACUUUCGGAC-GGGGGUUCGAUUCCCCC-CGCCUCCACCA Nme64t25
Cvi2t2      NNNNNNN----NNNNNNNN--NNNNNCGGGGGUUGC-----GAAGCAGAUGAGGGCAUAC--CGGGA-UUUCAGUCA--CCCCGUAAAAC----------GCUGAA---UUUAU-AUAGUCGCAAACGACGAAACU---------------------------------------------------------UACGCUCUGGCAGCCUAA---------------------CGGCCGGCCAGA---------------------------CACUACAACGGUUC-------------------GCAGAUGGGCCGG----GGGCG----------UCAA-------------------------------AACCCUGUAGUGUCACUCUACAUCUGCUA--GUGCUGUUCCGG-------------GUUACUUGGUUCAGUGC----GAAAUAAUAGGUAAC-UC------GCCAAAG-UCCAGCCUGUCCGUCGGCGUGG-CAGAGGU---UAAAU--CCAAAU---GACACGACUAAGUA-UGUAG----------------------AACUCACUGUAG------AGGACUUUCGGAC-GCGGGUUCAACUCCCNN-NNNNNNNNNNN Cvi2t2
Cvi3t1      GGGGGCG----ACC-UGGU--UUCGACGGGGGUUGC-----GAAGCAGAUGAGGGCAUAC--CGGGA-UUUCAGUCA--CCCCGUAAAAC----------GCUGAA---UUUAU-AUAGUCGCAAACGACGAAACU---------------------------------------------------------UACGCUCUGGCAGCCUAA---------------------CGGCCGGCCAGA---------------------------CACUACAACGGUUC-------------------GCAGAUGGGCCGG----GGGCG----------UCAA-------------------------------AACCCUGUAGUGUCACUCUACAUCUGCUA--GUGCUGUUCCGG-------------GUUACUUGGUUCAGUGC----GAAAUAAUAGGUAAC-UC------GCCAAAG-UCCAGCCUGUCCGUCGGCGUGG-CGGAGGU---UAAAU--CCAAAU---GACACGACUAAGUA-UGUAG----------------------AACUCACUGUAG------AGGACUUUCGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Cvi3t1
Nitrosomonadales
B1t18       NNNNNNN-----NNNNNNN--NNNNNNGUGGAUUGC-----AAAGCUAUCGAGGGCGUGU--CGAGG--AUCAGUUA--CCUCGUAAAUCCA--------UCUGAA---AAACA-GUAAACGCAAACGACGAACAG---------------------------------------------------------UUUGCUCUAGCAGCUUAA---------------------UCGCUCGCUAGA---------------------------UCUCACACCAGCUU-------------------GCCGAUGGGCUGG----GCAGGG---------UCAA------------------------------ACCUGCAGUGGGAUCAUCGCACAUCGGAUC--GCUGCGUGCAGG-------------GUUGCGAUGCAAGUGGC----UAAAUCAA--GCGAC-UC------GCGGUUGUCGUAGGGUGUCCCCUCCCGACAAUGAUCGU---UAAAA--CCAAAUAA-GAC--GACUACACA-CGUAG----------------------AACUUGUAGUGG------AGGAUUUGCGGAC-GUGGNNNNNNNNNNNNN-NNNNNNNNNNN B1t18
Neu2t2      GGGGGCG----AUC-CGGU--UUCGACGUGGGUUGC-----AAAGCAGCGCAGGGCAUAC--CGAGG--UUCAGUAC--CCUCGUAAAACA---------GCUGAA---AAAAA-AUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCCGCUUAA-----------------------UCCGGCUAAA---------------------------CUCCACACCGGUGG-------------------GCCUCAACGCCGG----GUCUG----------GCAA-------------------------------CAGACAGUGGAGUCAU-UAAC-GAGGAUC--GCGUUUUGCAGG-------------GUUACUUUGCAGAGCGC----UAAAAAAUAGGUAAC-UC------GCCUGUC-AUCAGCCUGCCGGUUGGCGGAU-GCCAGGU---CAAAU---UAAAU---AACAUGGCUAAGUA-UGUAG----------------------AACUGUCUGUAG------AGGACUUGCGGAC-GCGGGUUCAAUUCCCGC-CGCCUCCACCA Neu2t2
Ncr1t2      NNNNNNN----NNNNNNNN--NNNNNCGUGGGUUGC-----AAAGCAGCGCAGGGCAUAC--CGAGG--ACCAGAAUA-CCUCGUAAAUACA--------UCUGGA---AAAAA-AUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUUUAGCCGCUUAA-----------------------UACGGCUAGC---------------------------CUCUGCACCGAUGG-------------------GCCUUAACGUCGG----GUCUG----------GCAA-------------------------------CAGACAGCAGAGUCAU-UAGC-AAGGAUC--GCGUUCUGUAGG-------------GUCACUUUACAGAACGU----UAAACAAUAGGUGAC-UC------GCCUGCC-AUCAGCCCGCCAGCUGGCGGUU-GUCAGGU---UAAAU---UAAAG---AGCAUGGCUAAGUA-UGUAG----------------------AACUGUCUGUAG------AGGACUUGCGGAC-GCGGGUUCAACUCCCNN-NNNNNNNNNNN Ncr1t2
Nmu2t1      GGGGGCG-----ACUUGGC--UUCGACGUGGGUUGC-----AAAACAGAGCAGGGCAUAC--CGAGG--ACCAGUUA--CCUCGUAAAUACA--------UCUGGA----AACCAAUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCUCUAGCCGCUUAA----------------------AUCCGGCUGGA---------------------------CUCCGCACCGGUGG-------------------GCCUCAACGCCGG----GUCUG----------GCAA-------------------------------CAGACAGCGGAGCCAU-UAAC-GAGGAUC--GCGCCCGGUAGG-------------GUUACUUUACAGGGCGU----UAAACAAUAGGUGAC-UC------GCCUGCC-AUCAGUCCGCCGGUUGACGGAU-GCCAGGU---UAAAU---UAAAA---AACAUGGCUAAGUA-UGUAG----------------------AACUGCCUGUAG------AGGGCUUGCGGAC-GCGGGUUCAAUUCCCGC-CGCCUCCACCA Nmu2t1
B1t21       NNNNNNN----NNNNNNNN--NNNNNNGUGGGUUGC-----AAAGCAGUGCAGGGCAUAC--CGAGG--ACUAGUCA--CCUCGUAAAUCC---------ACUGGA--ACAAGUUAUAGUCGCAAACGACGAAACU---------------------------------------------------------UACGCUCUAGCCGCUUAA----------------------UCCCGGCUGGA---------------------------CGCUGCACCGGAGG-------------------GCCUCUCGGCCGG----GCGGA----------GCAA-------------------------------UCCGCAGCAGCGUCAU-AUAGAGAGGAUC--GUNNNNNNNNNN-------------NNNNNNNNNNNNNNNNN----NNNNNNNNNNNNNNN-NN------NNNNNNN-NNNNNNNNNNNNNNNNNNNNNN-NNNNNNN---NNNNN--NNNNNN---NNNNNNNNNNNNNN-NNNNN----------------------NNNNNNNNNNNN------NNNNNNNNNNNNN-NNNNNNNNNNNNNNNNN-NNNNNNNNNNN B1t21
Methylophilales
Mgl1t2      NNNNNNN----NNNNNNNN--NNNNNCGGGGGUUGC-----AAAGCAGCGCAGGGCAUAC--CGAGG--CCUAGUCA--CCUCGUAAAUAA---------ACUAGA---ACAAGUAUAGUCGCAAACGACGAAACU---------------------------------------------------------UACGCUCUAGCCGCUUAA----------------------UCCCGGCUGGA---------------------------CGCUGCACCGAAGG-------------------GCCUCUCGGUCGG----GUGGG----------GUAA-------------------------------CCCACAGCAGCGUCAU-UAAGAGAGGAUC--GUGCGAUAUUGG-------------GUUACUUAAUAUCGUAU----UAAAUCCAAGGUAAC-UC------GCCUGCU-GUUUGCUUGCUCGUUGGUGAGC-AUCAGGU---UAAAU---CAAAC---AACACAGCUAAGUA-UGUAG----------------------AACUGUCUGUGG------AGGGCUUGCGGAC-GGGGGUUCGAUUCCCNN-NNNNNNNNNNN Mgl1t2
Mfl2t1      GGGGCCG----ACC-AGGU--UUCGACGUGGGUUGC-----AAAGCAGCGCAGGGCAUAC--CGAGG--CCUAGUCA--CCUCGUAAAUAA---------ACUAGA---ACAAGUAUAGUCGCAAACGACGAAACU---------------------------------------------------------UACGCUCUAGCCGCUUAA----------------------UCCCGGCUGGA---------------------------CGCUGCACCGGAAG-------------------GCCUCUCGGCCGG----GCGG-----------GUAA--------------------------------CCGCAGCAGCGUCAU-UUAGAGAGGAUC--GUGUUGUAUUGG-------------GUUACUUAAUACAACAU----UAAAUCCAAGGUAAC-UC------GCCUGCU-GUUCGCUUGCUCGUUGGUGGGC-AUCAGGU---UAAAU---CAAAC---AACACAGCUAAGUA-UGUAG----------------------AACUGUCUGUGG------AGGGCUUGCGGAC-GGGGGUUCGAUUCCCCC-CGGCUCCACCA Mfl2t1
Rhodocyclales
Abh1t1      GGGGCCG----ACC-UGGC--UUCGACGUGGGUCGC-----GAAGCAGUGCAGUGCAUAC--CGAGG--ACCAGUCA--CCUCGUAAAUCCA--------UCUGGG---AAACU-ACAAACGCCAACGACGAGCGU---------------------------------------------------------UUCGCUCUCGCCGCUUAA----------------------UCCCGGCGGG----------------------------CGCUGCACCGGCAG-------------------GUCUCUGGGCCGG----GUGGUUCCAGC----GUAA----GCU----------------------GGGCCGCUGCAGUGUCAU-UUACAGAGAAUC--GCGAGCAGGGCCGG-----------GUUACUUGGCUCUGUAGC---UAAAGGUAAGGUAAC-UC------GCUGAUG-ACCGGCCUGCCGACCGGCUAAGUCAGAGGC---UAAAU--CCAAAUA--GGU-CGGCUAAGUA-UGUAG----------------------AGCUGUCUGUAG------AGGGCUUGCGGAC-GGGGGUUCGAUUCCCCC-CGGCUCCACCA Abh1t1
Aar2t1      GGGGGUG----CAC-CGGU--UUCGACAGGGCGGGC------AAUGGUGAGCAGGCAACC--CGAG---AGGCGACG---GACGUAAUC-----------CGCGCA---AAUCC-ACAAACGCCAACGAUGAGCGU---------------------------------------------------------UUCGCUGUAGCCGCUUAA------------------------GGCAACAGC---------------------------CGGGGCC--------------------------GCCUG-------------------------------------------------------------------AGCCCUGUUAC-CAAAGA-CGGC---UGGCGGGGGCUUCG------------------GCCCCCGCU-UCA*******************************************************************************************AUGGU-UGUAA--------------------UUCCGGCAACCCGG------AGACGUUCUGGAC-GCGGGUUCGAUUCCCGC-CACCUCCACag Aar2t1
Dar1t1      GGGGGUG----UAC-UGGU--CUCGACAGGGCGGAC------AAAGGUGCGCAGGCAACU--CGUC---AGGCGAUC---GACGUUAAU-----------GAAGCA---AAUCC-AUAAUUGCCAAUGAUGAGCAA---------------------------------------------------------UUCGCUAUUGCCGCCUAA----------------------AAACGGUUAGC---------------------------CGGGGCU--------------------------GCUAG-------------------------------------------------------------------AGCCUUGUUAC-CAAAGAUAGC----CGGCGGGGACUUCG------------------GUCCCCGUCGUCA*******************************************************************************************AUGGU-UGUAA--------------------UUCCGGCAAUCUGG------AGGCGUUCUGGAC-AGGGGUUCGAUUCCCCU-CACCUCCACCc Dar1t1
Dag1t1      GGGGGUG----UAC-UGGC--UUCGACAGGGCGGGC------AAAGGUGCGCAGGCAACC--CGAG---AGGUGACG---GACGUAAUC-----------CGCACA---AAUCC-AUAAUUGCCAAUGAUGAGCAA---------------------------------------------------------UUCGCUAUCGCCGCCUAA----------------------AAACGGCUAGC---------------------------UGGGGCC--------------------------GCUGA-------------------------------------------------------------------AGCCUUAUUAC-CCAAGACAGC----CGGCNNNNNNNNNN------------------NNNNNNNNNNNNN*******************************************************************************************NNNNN-NNNNN--------------------NNNNNNNNNNNNGG------AGGCGUUCUGGAC-AGGGGUUCGAUUCCCCU-CACCUCCACCc Dag1t1
Rco1t1      GGGGGUG----UAC-UGGC--UUCGACAGGGCGGGC------AAAGGUGCGCAGGCAACU--CGUC---AGGCGAUC---GACGUUAAU-----------GAAGCA---AAUCU-CCAAACGCCAACGAUGAGCGU---------------------------------------------------------UUCGCAAUCGCCGCUUAA------------------------GGCUUUUGC---------------------------CGAGGCU--------------------------GCUUG-------------------------------------------------------------------AGCCUUGUUAC-CAAAGAAAAGC---CGGUNNNNNNNNNN------------------NNNNNNNNNNNNN*******************************************************************************************NNNNN-NNNNN--------------------NNNNNNNNNNNNGG------AGGCGUUCUGGAC-GCGGGUUCGAUUCCCGC-CACCUCCACCu Rco1t1
Hydrogenophilales
Tde1t1      GGGGCCG----ACC-UGGC--UUCGACGUGGGUCGC-----AAAGCAGCGUAGGGCAUAC--CGAGG-GUCAGAGCA--CCUCGUAAAUCC---------AACUGA---AAAACUUUAGUCGCAAACGACGAAAAC---------------------------------------------------------UACGCCCUGGCCGCUUAA------------------------GGUCCAGG----------------------------ACUCACACUAGCCU-------------------GUUCAUGGGCUAG----GCCGGG---------UCAA------------------------------ACCGGCAGUGAGUUAAU-UCACAUGAAAUC--GCGCUUGUCCGG-------------GUCGCUUGGGCAGGUGC----UAAAUCCAAGGCGGC-UC------GGCGAAA-UCCAGCCUGUUCGGCGGGCGUGAUGGAGCU---UAAAGCUUAAAAA---CACCGGACUAAGUA-UGUAG----------------------AACUGCCUGUAG------AGGGCUUGCGGAC-GCGGGUUCGAUUCCCGC-CGGCUCCACCA Tde1t1
Burkholderiales
Cte4t1      GGGGCCG----AUUCUGGA--UUCGACGUGGGUUCG-----GGACCGGUGCGGUGCAUGU--CGAGC-UUGAGUGAC--GCUCGUAAAUCUC--------CAUUCA---AAAAA-CUAACUGCAAACGACGAACGU---------------------------------------------------------UUCGCACUCGCCGCUUAA-----------------------UCCGGUGAG----------------------------CCUUGCAACAGCAC-------------------GCUAGUGGGCUGG----GCAAGGGGGUA----GCAA----UACC---------------------UCCCGGCUGCAAGGGAAU-UUUCAUUAGCUG--GCUGGAUACCGG-------------GCUUCUUGGUAUUUGGC----GAGAUUUUAGGAAGC-UG------GCUACCCAAGCAGCGUGUGCCUGCGGGGUUUGGGUGGU---GAGAU--UUAAAA---CAGAGCACUAAACA-UGUAG----------------------AUCUGUCCGGCG------AAGGCUUACGGAC-GCGGGUUCAAUUCCCGC-CGGCUCCANNN Cte4t1
Dac1t4      GGGGCUG-----UCCUGGU--UUCGACGUGGGUUCG-----GGACCGGUGUGGUGCAUGU--CGAGC-UUGAGUGAC--GCUCGUAAAUCUC--------CAUUCA---AAAAA-CUAACUGCAAACGACGAACGU---------------------------------------------------------UUCGCACUCGCCGCUUAA----------------------AUCCGGUGAG----------------------------CCUUGCAACAGCAC-------------------GCUGAUGGGCUGG----GCAAGGGGGUA----GCAA----UACC---------------------UCCCGGCUGCAAGGGAAU-UUACAUCAGCUG--GCUGCGUGCUGG-------------GCUUCUUAGUACGUGGC----AAGAUCCAAGGAAGC-UG------GCAUCCCGGGUAGCGUGCGCCUGCGCGACUUGGGAGGC---GAGAC--UCAAAA---CAGAACGCUAAACA-UGUAG----------------------AUCUGCCCGGCG------AAGGCUUGCGGAC-GCGGGUUCAAUUCCCGC-CAGCUCCACCA Dac1t4
Pjs1t1      GGGGCUG----CAC-UGGU--UUCGACGCGGGUACG-----GACGCGCAGUGGGGCAUGC--CGAGC---UUAGUGU--GCUCGUAAAACU---------GACUAA--AACAAA-CUAACUGCAAACGACGAACGU---------------------------------------------------------UUCGCACUCGCUGCUUAA---------------------UAACCAGUGAG----------------------------CCCUACAACAGCAG-------------------GCCGAUGGGCUGG---GCAAGGGGUCUUUAGCGCAAGUUGAAGG--------------------CUCCCGGCUGUAGGGUCAU-ACACAUCGGCUG--GCCUGGUACCGG-------------GCACCUUGGUAUCAGGC----GAGACAAUAGGAUGC-UG------GCAACCUGUAUAGCGUGCUGCUGCGCGAUACGGGAAGU---GAGAC--UCAAAU---CAGACGGCUAAGCA-UGUAG----------------------AACUACGCGAAG------AAGGCUUGCGGAC-GGGGGUUCAAAUCCCCC-CAGCUCCACCA Pjs1t1
Vpa1t2      NNNNNNN----NNNNNNNN--NNNNNCGUGGGUUCG-----GAGUCGCAGCGGGGCAUGU--CGAGC---UGAAUGC--GCUCGUAAAACAG--------AUUCAA---ACAAA-CUAACUGCAAACGACGAACGU---------------------------------------------------------UUCGCACUCGCUGCUUAA---------------------UUGCCAGUGAG----------------------------CCUUGCAACAGUUG-------------------GCCGAUGGGCUGG----GCAAGGGGGUCUGGAGCAAUCCUGACC---------------------UCCCGGCUGCAAGGAUAA-CUACAUGGGCUG--GCUCCGAUCCGG-------------GUACCUUGGGUCGGGGC----GAGAAAAUAGGGUAC-UG------GCGUCCGGUUUAGCGUGUGACUGCGCGACUCCGGAAGU---GAGAC--UCAAAA---CAGAUCACUAAACA-UGUAG----------------------AACUGCGCGAUG------AAGGCUUGCGGAC-GGGGGUUCAACUCCCNN-NNNNNNNNNNN Vpa1t2
Hpa6t2      NNNNNNN----NNNNNNNN--NNNNNCGUGGGUUCG-----GACGCGCAGCAGGGCAUGU--CGAGG--UUCUGUCA--CCUCGUAAAUCA---------GCAGAA---AAAAA-CCAACUGCAAACGACGAACGU---------------------------------------------------------UUCGCACUCGCCGCUUAA---------------------ACACCGGUGAG----------------------------CCUUGCAACAGCAG-------------------GCCGAUGGGCUGG----GCAAGGGGGUC----GCAA----GACC---------------------UCCCGGCUGCAAGGUAAU-UUACAUCGGCUG--GUUCUGCGUCGG-------------GCACCUUGGCGCAGGAU----GAGAUUCAAGGAUGC-UG------GCUUCCCGUUUAGCGUGCCACUGCGCGACUCGGGCGGU---GAGAC--CCAAAU---CAGACGGCUACACA-UGUAG----------------------AACUGCUCGAAA------AAGGCUUGCGGAC-GGGGGUUCAACUCCCNN-NNNNNNNNNNN Hpa6t2
Mpe2t1      GGGGCCG----ACC-UGGU--UUCGACGUGGGUGCG-----GAAUUGGAGUGGUGCAUGC--CGAGC--AUCAGUGA--GCUCGUAAAUCC---------AGCUGA---AACAAACCAACUGCGAACGACGAACGU---------------------------------------------------------UUCGCCCUCGCCGCUUAA---------------------ACACCGGUGAG----------------------------CGUCUCAACGGCAG-------------------GCCGAUGGGCCGG----GCCCAA--GCC----GCAA----GGU----------------------GGAAGGCUGAGACGUCAU-GCACAUCGGCUG--GUUGCUCGUCGG-------------GUCACUCGGCGUUCAAC----GAGAC-UC-AGUGAC-UG------GCGUUGUCCGUAGCGUGCUUCUGCGCGACG-GCGGCGU---GAGAC--UCAAAU---CAGACAGCUAAGCA-UGUAG----------------------AUCUACCUGAGG------AUGGCUUGCGGAC-GGGGGUUCGAUUCCCCC-CGGCUCCACCA Mpe2t1
Rpi1t2      NNNNNNN----NNN-NNNN--NNNNNCGGGGGUUGC-----GAAGCAGCGGAGGGCAUAC--CGAGG--ACCCGUCA--CCUCGUUAAUCA---------AUGGGA---AUGCA-AUAACUGCUAACGACGAACGU---------------------------------------------------------UACGCACUGGCAGCCUAA----------------------GGGCCGCCGU----------------------------CCUCGCACUGGCUC-------------------GCUGACGGGCUAG----GGUC-----------GCAA-------------------------------GACCA-GCGAGGUCAU-UUACGUCAGAUA--AGCUUUAGGUGA-------------GUCACGGGCCUAGAGAC----GAAAA-CUUAGUGAA-UC------GCCGUCG-UAGAGCGUGUUCGUCCGCGAUG-CGGCGGU---UAAAU---CAAAU---GACAGAACUAAGUA-UGUAG----------------------AACUCUCUGUGG------AGGGCUUGCGGAC-GCGGGUUCGAUUCCCNN-NNNNNNNNNNN Rpi1t2
Rso5t6      GGGGCCG----ACC-UGGU--UUCGACGUGGGUUGC-----GAAGCAGUAGCGGGCAUAC--CGAGG--ACCCGUCA--CCUCGUUAAUCA---------AUGGGA---ACGCA-AUAACUGCUAACGACAACCGU---------------------------------------------------------UACCAGCUGGCCGCUUAA---------------------UUGCGCGCCGU----------------------------CCUCGCACUAGCUU-------------------GCCGAUAGGCUAG----GGCC-----------GCAA-------------------------------GGCCACGCGAGGUCAU-UCAUAUCGGAUC--GCUUCGGCCGGU-------------GUCACGACGGCCGGGGU----UAACU-CCAAGUGAC-UC------GUCGUCG-CGCAGCGUGUUCGUCCGCGUCG-CGCCGGU---UAAAU---CAAAU---GACUGAACUAAGUA-UGUAG----------------------AACGCUCUGUAG------AGGACUUGCGGAC-GCGGGUUCGAUUCCCGC-CGGCUCCACCA Rso5t6
Reu1t4      NNNNNNN----NNN-NNNN--NNNNNCGUGGGUUAC-----AAAGCAGUGGAGGGCAUAC--CGAGG--ACCCGUCA--CCUCGUUAAUCA---------AUGGGA---AUGCA-AUAACUGCUAACGACGAACGU---------------------------------------------------------UACGCACUGGCCGCUUAA----------------------UUGCGGCCGU----------------------------CCUCGCACUGGCUC-------------------GCUGACGGGCUAG----GGUC-----------GCAA-------------------------------GACCACGCGAGGUCAU-UUACGUCAGAUA--AGCUCCGGAAGG-------------GUCACGAAGCCGGGGAC----GAAAA-CCUAGUGAC-UC------GCCGUCG-UAGAGCGUGUUCGUCCGCGAUG-CGCCGGU---UAAAU---CAAAU---GACAGAACUAAGUA-UGUAG----------------------AACUCUCUGUGG------AGGGCUUACGGAC-GCGGGUUCGAUUCCCGC-CGGCUCCACCA Reu1t4
Rpi2t5      GGGGCCG----ACC-UGGU--UUCGACGUGGGUUGC-----GAAGCAGCGGAGGGCAUAC--CGAGG--ACCCGUCA--CCUCGUUAAUCA---------AUGGGA---AUGCA-AUAACUGCUAANNNNNNNNNN---------------------------------------------------------NNNNNNNNNNNNNNNNNN----------------------NNNNNNNNNN----------------------------NNNNNNNNNNNNNN-------------------NNNNNNNNNNNNN----NNNNN----------NNNN-------------------------------NNNNNNNNNNNNNNNN-NNNNNNNNNNNN--NNNNNNNNNNNN-------------NNNNNNNNNNNNNNNNN----NNNNN-NNNNNNNNN-NN------NNNNNNN-NNNNNNNNNNNNNNNNNNNNNN-NNNNNNN---NNNNN---NNNNN---NNNNNNNNNNNNNN-NNNNN----------------------NNNNNNNNNNNN------NNNNNNNNNNNNN-NNNNNNNNNNNNNNNNN-NNNNNNNNNNN Rpi2t5
Reu2t1      GGGGCCG----ACC-UGGU--UUCGACGUGGGUUGC-----GAAGCAGUGGAGGGCAUAC--CGAGG--ACCCGUCA--CCUCGUUAAUCA---------AUGGGA---AUGCA-AUAACUGCUAACGACGAACGU---------------------------------------------------------UACGCACUGGCAGCCUAA----------------------GGGCCGCCGU----------------------------CCUCGCACUGGCUC-------------------GCUGACGGGCUAG----GGUUC----------GCAA-------------------------------GAACCAGCGAGGUCAU-UUACGUCAGAUA--AGCCCCGUCGGU-------------GUCACGACUGCGGGGAC----GAAAA-CCAAGUGAC-UC------GCCGUCG-UAGAGCGUGUUCGUCCGCGAUG-CGGCGGU---UAAAU---CAAAU---GACAGAACUAAGUA-UGUAG----------------------AACUCUCUGUGG------AGGGCUUGCGGAC-GCGGGUUCGAUUCCCGC-CGGCUCCACCA Reu2t1
Cme1t3      GGGGCCG----ACC-UGGU--UUCGACGUGGGUUAC-----AAAGCAGUGGAGGGCAUAC--CGAGG--ACCCGUCA--CCUCGUUAAUCA---------AUGGGA---AUGCA-AUAACUGCUAACGACGAACGU---------------------------------------------------------UACGCACUGGCAGCCUAA----------------------GGGCCGCCGU----------------------------CCUCGCACUGGCUC-------------------GCUGACGGGCUAG----GGUUC----------GCAA-------------------------------GAACCAGCGAGGUCAU-UUACGUCAGAUA--AGCUUCGGGAGU-------------GUCACGGGCCCGAGGAC----GAAAA-CCUAGUGAC-UC------GCCGUCG-UAGAGCGUGUUCGUCCGCGAUG-CGCCGGU---UAAAU---CAAAU---GACAGAACUAAGUA-UGUAG----------------------AACUCUCUGUGG------AGGGCUUGCGGAC-GCGGGUUCGAUUCCCGC-CGGCUCCACCA Cme1t3
Bth30t6     GGGGGCG----ACC-UGGU--UUCGACAGGGGUUGU-----GAAGCGGCU-AGGGCAUGU--CGAGG--ACCCGUCA--CCUCGUUAAUCA---------AUGGGA---AAAAC-GUAACUGCAAACGACGAUACG---------------------------------------------------------UUCGCACUGGCAGCCUAA----------------------GGGCCGCCGU----------------------------CCUCUGCCUAGUUC-------------------ACUGACGGGCUAGU-----------GUC----GCAA----GAC--------CGGUAGCAAUACCG-------ACAGAGGUCAU-AUACGUCAGUUA--AGCCUGUCCGGC-------------GUCACGACGGCCAGGUC----GAAAA-UUGAGUGAA-UC------GCCGUAA-CGGAGCGUGUUCGUCCGCGACG-UCACGGU---UAAAU---CAAAC---GACAGAACUAAACA-UGUAG----------------------AACUGGUCGUGG------ACCGCUUCUGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Bth30t6
Bma6t60     GGGGGCG----ACC-UGGU--UUCGACAGGGGUUGU-----GAAGCGGCU-AGGGCAUGU--CGAGG--ACCCGUCA--CCUCGUUAAUCA---------AUGGGA---AAAAC-GUAACUGCAAACGACGAUACG---------------------------------------------------------UUCGCACUGGCAGCCUAA----------------------GGGCCGCCGU----------------------------CCUCUGCCUAGUUC-------------------ACUGACGGGCUAGU-----------GUC----GCAA----GAC--------CGGUAGCAAUACCG-------ACAGAGGUCAU-AUACGUCAGUUA--AGCCUGUCCGGC-------------GUCACGACGGACAGGUC----GAAAA-UCAAGUGAA-UC------GCCGUAA-CGGAGCGUGUUCGUCCGCGACG-UCACGGU---UAAAU---CAAAU---GACAGAACUAAACA-UGUAG----------------------AACUGGUCGUGG------ACCGCUUCUGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Bma6t60
Bma6t60     GGGGGCG----ACC-UGGU--UUCGACAGGGGUUGU-----GAAGCGGCU-AGGGCAUGU--CGAGG--ACCCGUCA--CCUCGUUAAUCA---------AUGGGA---AAAAC-GUAACUGCAAACGACGAUACG---------------------------------------------------------UUCGCACUGGCAGCCUAA----------------------GGGCCGCCGU----------------------------CCUCUGCCUAGUUC-------------------ACUGACGGGCUAGU-----------GUC----GCAA----GAC--------CGGUAGCAAUACCG-------ACAGAGGUCAU-AUACGUCAGUUA--AGCCUGUCCGGC-------------GUCACGACGGACAGGUC----GAAAA-UCAAGUGAA-UC------GCCGUAA-CGGAGCGUGUUCGUCCGCGACG-UCACGGU---UAAAU---CAAAU---GACAGAACUAAACA-UGUAG----------------------AACUGGUCGUGG------ACCGCUUCUGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Bma6t60
Bxe1t1      GGGGGCG----ACC-UGGU--UUCGACAGGGGUUGC-----GAAGCGGCU-AGGGCAUGU--CGAGG--ACCCGUCA--CCUCGUUAAUCA---------AUGGGA---AAAAC-GUAACUGCAAACGACGAUACG---------------------------------------------------------UUCGCACUGGCAGCCUAA----------------------GGGCCGCCGU----------------------------CCUCUGCCUAGUUU-------------------ACUGACGGGCUAGA-----------GUC----GCAA----GAC--------CGGUAGCAAUACCG-------ACAGAGGUCAU-AUACGUCAGUUA--AGCCUUGGUGGU-------------GUCACGACAUCCGGGUC----GAAAA-UCUAGUGAA-UC------GCCGUAG-UGCAGCGUGUUCGUCCGCGUCG-CUACGGU---UAAAU---CAAAU---GACAGAACUAAACA-UGUAG----------------------AACUGGUCGUAG------AGUGCUUCUGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Bxe1t1
Bce132t3    GGGGGCG----ACC-UGGU--UUCGACAGGGGUUGU-----GAAGCGGCU-AGGGCAUGU--CGAGG--ACCCGUCA--CCUCGUUAAUCA---------AUGGGA---AAAUC-GUAACUGCAAACGACGAUACG---------------------------------------------------------UUCGCACUGGCAGCCUAA----------------------GGGCCGCCGU----------------------------CCUCUGCCUAGUUC-------------------ACUGACGGGCUAGU-----------GUC----GCAA----GAC--------CGGUAGCAAUACCG-------ACAGAGGUCAU-UUACGUCAGUUA--AGCCCUGUCGGC-------------GUCGCGACGCCAGGGUC----GAAAA-UCUAGCGAA-UC------GCCGUAG-UGCAGCGUGUUCGUCCGCGUCG-CUGCGGU---UAAAU---CAAAA---GACUGGACUAAACA-UGUAG----------------------AACUAGUCGUGG------AGCGCUUCUGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Bce132t3
Bvi1t2      GGGGGCG----ACC-UGGU--UUCGACAGGGGUUGU-----GAAGCGGCU-AGGGCAUGU--CGAGG--ACCCGUCA--CCUCGUUAAUCA---------AUGGGA---AAAAC-GUAACUGCAAACGACGAUACG---------------------------------------------------------UUCGCACUGGCAGCCUAA----------------------CGGCCGCCGU----------------------------CCUCUGCCUAGUUC-------------------ACUGACGGGCUAGU-----------GUC----GCAA----GAC--------CGGUAGCAAUACCG-------ACAGAGGUCAU-AUACGUCAGUUA--AGCCUUGGCGGC-------------GUCGCGACGUCCGGGUC----GAAAA-CUUAGCGAA-UC------GCCGUAG-UGCAGCGUGUUCGUCCGCGUCG-CUGCGGU---UAAAU---CAAAU---GACUGAACUAAACA-UGUAG----------------------AACUAGUCGUGG------AGCGCUUCUGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Bvi1t2
B381t4      GGGGGCG----ACC-UGGU--UUCGACAGGGGUUGU-----GAAGCGGCU-AGGGCAUGU--CGAGG--ACCCGUCA--CCUCGUUAAUCA---------AUGGGA---AAAUC-GUAACUGCAAACGACGAUACG---------------------------------------------------------UUCGCACUGGCAGCCUAA----------------------CGGCCGCCGU----------------------------CCUCUGCCUAGUUC-------------------ACUGACGGGCUAGU-----------GUC----GCAA----GAC--------CGGUAGCAAUACCG-------CCAGAGGUCAU-UUACGUCAGUUA--AGCCCUGUCGGC-------------GUCGCGACGCCAGGGUC----GAAAA-CCUAGCGAA-UC------GCCGUAG-UGCAGCGUGUUCGUCCGCGUCG-CUGCGGU---UAAAU---CAAAU---GACUGAACUAAACA-UGUAG----------------------AACUAGUCGUGG------AGCGCUUCUGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA B381t4
Avi2t2      NNNNNNN-----NNNNNNN--NNNNNNGUGGGUCGC-----GAAACAACUCAGGGCAUGC--CGAGC--ACCAGUAC--GCUCGUUAAACC---------ACUGGA---ACACU-ACAAACGCCAACGACGAGCGU---------------------------------------------------------UUCGCUCUCGCCGCUUAA------------------------GCGGUGAGC---------------------------CGCUGCACUGAUCU-------------------GUCCUUGGGUCAG-GCGG--------AGGAAGGCAACUUCCCA--------GGGGGGCAACCCUCGAACCGCAGCAGCGACAU-UCACAAGGAAUC-GGUUUGAACUGGG-------------GUCACA-CGGUUCAAAU----UUAAA-UUACGUGAA-UC------GCUCUGG-UCCGGCCUGUCGGUUGGCUAAGUCCAGGGU---UAAAA--CCAAAUA--GAU-CGACUACGCA-UGUAG----------------------AACUGGUUGCGG------AGGGCUUGCGGAC-GGGGNNNNNNNNNNNNN-NNNNNNNNNNN Avi2t2
Afa2t2      NNNNNNN----NNN-NNNN--NNNNNCGGGGGUCAA-----GAAGCAGCACAGGGCGUGU--CGAGC--ACCAGUAC--GCUCGUAAAUCC---------ACUGGA---AAACU-AUAAACGCCAACGACGAGCGU---------------------------------------------------------UUCGCUCUAGCCGCUUAA------------------------GGCUGGGC----------------------------CACUGCACUAAUUU-------------------GUCUUUGGGUUAG----GUAGG----------GCAA-------------------------------CCUACAGCAGUGUUAU-UUACAAAGAAUC--GAAUCGGUCUGC-------------GCCACGAAGUCCGGUUC----UAAAA-CUUAGUGGA-UC------GCCAAGG-AAAGGCCUGUCAAUUGGCAUAGUCCAAGGU---UAAAACUUAAAAUU--AAU-UGACUACACA-UGUAG----------------------AACUGUCUGUGG------ACGGCUUGCGGAC-GGGGGUUCGAUUCCCNN-NNNNNNNNNNN Afa2t2
Bbr7t22     GGGGCCG----AUC-CGGA--UUCGACGUGGGUCAU-----GAAACAGCUCAGGGCAUGC--CGAGC--ACCAGUAA--GCUCGUUAAUCC---------ACUGGA---ACACU-ACAAACGCCAACGACGAGCGU---------------------------------------------------------UUCGCUCUCGCCGCUUAA------------------------GCGGUGAGC---------------------------CGCUGCACUGAUCU-------------------GUCCUUGGGUCAG-GCGG--------GGGAAGGCAACUUCCCA---------GGGGGCAACCCC-GAACCGCAGCAGCGACAU-UCACAAGGAAUC-GGCCACCGCUGGG-------------GUCACA-CGGCGUUGGU----UUAAA-UUACGUGAA-UC------GCCCUGG-UCCGGCCCGUCGAUCGGCUAAGUCCAGGGU---UAAAU--CCAAAUA--GAU-CGACUAAGCA-UGUAG----------------------AACUGGUUGCGG------AGGGCUUGCGGAC-GGGGGUUCAAUUCCCCC-CGGCUCCACCA Bbr7t22
Bbr7t22     GGGGCCG----AUC-CGGA--UUCGACGUGGGUCAU-----GAAACAGCUCAGGGCAUGC--CGAGC--ACCAGUAA--GCUCGUUAAUCC---------ACUGGA---ACACU-ACAAACGCCAACGACGAGCGU---------------------------------------------------------UUCGCUCUCGCCGCUUAA------------------------GCGGUGAGC---------------------------CGCUGCACUGAUCU-------------------GUCCUUGGGUCAG-GCGG--------GGGAAGGCAACUUCCCA---------GGGGGCAACCCC-GAACCGCAGCAGCGACAU-UCACAAGGAAUC-GGCCACCGCUGGG-------------GUCACA-CGGCGUUGGU----UUAAA-UUACGUGAA-UC------GCCCUGG-UCCGGCCCGUCGAUCGGCUAAGUCCAGGGU---UAAAU--CCAAAUA--GAU-CGACUAAGCA-UGUAG----------------------AACUGGUUGCGG------AGGGCUUGCGGAC-GGGGGUUCAAUUCCCCC-CGGCUCCACCA Bbr7t22
Bbr7t22     GGGGCCG----AUC-CGGA--UUCGACGUGGGUCAU-----GAAACAGCUCAGGGCAUGC--CGAGC--ACCAGUAA--GCUCGUUAAUCC---------ACUGGA---ACACU-ACAAACGCCAACGACGAGCGU---------------------------------------------------------UUCGCUCUCGCCGCUUAA------------------------GCGGUGAGC---------------------------CGCUGCACUGAUCU-------------------GUCCUUGGGUCAG-GCGG--------GGGAAGGCAACUUCCCA---------GGGGGCAACCCC-GAACCGCAGCAGCGACAU-UCACAAGGAAUC-GGCCACCGCUGGG-------------GUCACA-CGGCGUUGGU----UUAAA-UUACGUGAA-UC------GCCCUGG-UCCGGCCCGUCGAUCGGCUAAGUCCAGGGU---UAAAU--CCAAAUA--GAU-CGACUAAGCA-UGUAG----------------------AACUGGUUGCGG------AGGGCUUGCGGAC-GGGGGUUCAAUUCCCCC-CGGCUCCACCA Bbr7t22
Bav1t1      GGGGCCG----AUC-CGGA--UUCGACGUGGGUCAU-----GAAACAGUUCAGGGCAUGU--CGAGC--ACCAGUAC--GCUCGUAAAACC---------ACUGGA---AACAAUACAAACGCCAACGACGAGCGU---------------------------------------------------------UUCGCUCUCGCCGCUUAA------------------------GCGGUGAGC---------------------------CGCUGCACUGAUCU-------------------GUCCUUGGGUCAG-GCGGAGGAAGCAACUCCCGUAAGGGAGCCAUCGCCUAAAGGGGCAACCCUUGAACCGCAGCAGUGUUAU-UCACAAGGAAUC-GGUCUGCGCUGGG-------------GUCACA-CGGUUCAGGC----UUAAA-UUACGUGAA-UC------GCUUCGG-UCCGGCCCGUUGAUCGGCUAAGUCCGGGGU---UAAAU--CCAAAUA--GAU-CAACUAAGCA-UGUAG----------------------AACUGACUGCGG------AGGGCUUGCGGAC-GGGGGUUCAAUUCCCCC-CGGCUCCACCA Bav1t1
OTHER PROTEOBACTERIA
unclassified Proteobacteria
Mma1t1      GGGGGUG-----AACUGGC--UUCGACGGGGUGUGG-----AACGGUUAGCAAGGCGACU--CGGAA---UGGUAC---CUACGUACAGG----------ACCAA-----ACUUUACAAUUGCCAAUGACGAGCAC------------------------------------------------UACGCUCCGGCUUUUGCAGCUGCAUAA---------------------AGUAGUUGUACAAAGCGGGGU------------------CUGAACCCGGGCCCGGCAACAGAAGCUUUUAGCGGGGUUAAGCCGGAACUGUGUAGGCCGGUGUAAAUCCAGGGACACCCAGUUCUCCGAGGUAACGGGG--------------------------------------------------------------------------------------------------------GCUAUGUGGUCAGCCAGCCUGAGACGCCACAAAGC--------AGUA-----GGGUUGGCAAAAUGGU-CGUGA----------------------UUCCUUCUAGCUU--AAUACAUAUUUCGGAC-CGGGGUUCGACUCCCCG-CACCUCCACCA Mma1t1
Acidithiobacillia
Afe4t3      GGGGGCG------ACCGGC--UUCGACGCAGGUCGC------GAAGCCUUCGGUGCAUGC--AGAGC--UGCGGUUC--GCUCUUAAAACU---------GGUCGCA---GAUUCAUAAUUGCCAACGACAGCAAU---------------------------------------------------------UACGCUCUCGCUGCUUAA----------------------------GCAGUGAG------------------------CCCUCUGCCCGGAUUU-----------------GUCUGUGGAUCCGGAGCCGAAAGGCGCGCGGAGGG--------------------------------------------UCAUGAAACACGGAAUC--GUGCGCAUUCUA--------------GUCUGUGGGAUGCGCGC---UAAAUUAAAG-CAGAAUC------GCCAUGUCGUCAUCCU-GUCUGUC-GGAGGGCGGUGCGGU----UAAAGCCAAAA--GACAA-ACUACGCA-UGUAG----------------------AUCCGGUGGUCU------AGGUACUGCGGAC-GCGGGUUCAAUUCCCGC-CGCCUCCACCA Afe4t3
Deltaproteobacteria
Lin3t6      GGGGACG-----CACUGGU--UUCGACGGGGAUGUG------GAAACCAAAGUGGCAGGU--CGAGG--CGCCGCUG-GCCUCGUAAAA-----------AGCGGCA---ACAAUGUAAUUGCAAACAACAAUUAC------------------------------------------------------GACUACGCUCUUGCUGCAUAA-----------------------GUAAUAGCGUACCUGGCUAUUUAAAUAGCCA------CGUCAAUCCUGCUGA---------------UGUCUGAUAAGCUGGUGCGGCG----------------------------------------------------------ACA------AUCAUCAGG---CUAGCAGCCUAUUGU-------GUUUA-CUGGAUAGUCUGCGAAAUUAU---UACAGUAAACUU-----GUUUUGAUCU--GCCUGGCU-AAG-GGCUAGAAUCAAAAU-----AAGAUGUAAA---CUU-AGCCUAAACC-UGUAG----------------------AUACUUUGUGUGG-----AACUUUCUCGGAC-GCGGGUUCGAUUCCCGC-CGUCUCCACCA Lin3t6
Dde5t1      NNNNNNN-----NNNNNNN--NNNNNNGGGGACGUG------GAAGCCGUAGCGGCAGGU--CGAGG--CGCCGCUG-GCCUCGUAAAA-----------AGCGGCA---CAAAAGUAAUUGCCAACAACGAUUAC------------------------------------------------------GACUACGCUUACGCUGCCUAA----------------------UAACAGCGAGGCAAUGACCGUUUA-ACGGUCG------CGCCGAUCAGGGCCA---------------UGCCUGAUAACCCUGAUUGGCG----------------------------------------------------------ACAC-----UU-AUCAGG---CUGGCGAAAACCGGC-------UCUCGCCGGGGUUUUUCGCGAGGAGUUUA--CCGGCGGGAUU-----GCUGCGUUGU--GCCUGGUC-AGG-GGCCAACAGCGCGGU-----GAAAUACAUA---CUU-GACCUAAACC-UGUAG----------------------AUGCUUCGUGUGG-----AAUGUUCUCGGAC-GGGGNNNNNNNNNNNNN-NNNNNNNNNNN Dde5t1
Dal2t1      GGGGGCG-----CACUGGU--UUCGACGGGGAUAAA------GAAGCCGGAGUGGCAGGU--CGAGG--CGCCGCUG-GCCUCGUUAAA-----------AGCGGCA---CAAAUGUAAUUGCCAACAACGAUUAC------------------------------------------------------GAAUACGCAAUGGCAGCCUAA---------------------UUAGGCUUGCCG---------------------------CACUGAUUGGCUGAC----------------GUCAGAUACGCCGACCAGUG-----------------------------------------------------------ACAA----ACUUAUCCGA---CUGGCACCCAAAGCC---------GUCUGUCGCAGCGGGUGUAAGAUUUUUUAA-GACAGACUU-----GCCGCCGGUA--GCCCGAUC-AGG-GGCAUCACCGGAUGGC----GAGCUUGAAUA--CCU-GAUCUAAACC-UGUAG----------------------AAGCUUCGAGUGG-----ACUGUUCUCGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Dal2t1
Dvu4t3      GGGGGCG-----CACUGGU--UUCGACGGGGACGUA------GAAGCCGGAGUUGCAGGC--CGAGG--CGCCGCUG-GCCUCGUAAAA-----------AGCGGCA---CAAAAGUAAUUGCCAACAAU---UAC------------------------------------------------------GACUACGCUCUGGCUGCUUAA---------------------UUGACGGCCA-----------------------------CGUCGAACCGGUUCA---------------CGCCUGAUAGACCGGUGAGACG----------------------------------------------------------UAAC-----UUCAUCAGG---CUGGCAUCUGACGGC-------GCUCGCCGCGAAGGG-UGCGAGAAAAA----CAGGUGAGCUG-----GUCGAAGGUU--GCCUGGUC-GGG-GGCGAAACCUGAGAU-----GACGAUUGUA---CUC-GACCUAAGCC-UGUAG----------------------ACGCUUCGUGUGG-----AACAUUCUCGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Dvu4t3
Dps1t1      GGGGGCG-----AAACGGC--UUCGACGGGGAUGUA-----UAAGCUCUACGUUGCAUGU--CGAGC--AACUGCC--AGCUCGUAAAAAA---------GGCGGAAA--CUAAUAUAAUCGCAGACGAU---UAU------------------------------------------------------AACUACGCAGUAGCAGCUUAA---------------------UAACUGUCAUACUGC------------------------CGUCUCUCCAGUCCUC---------------CGCUCAUGAGGGUUGGGUCCGAGGCG-----------------------------------------------------UCGACCAAA---AUGAGC---UAGCAAUCGGGUGGUG----------UUCUGGUCGCCCCGGCGCGAAAAUAUA----CAGAAUA-----GCGUUAUAGUAUCCCUGUUCCGAC-GGAAGCUAAAUCGC------GAAAACUAA----GUGGGAACUAAACA-UGUAG-----------------------AUACGAGAGGGG-----AGCAUUUGCGGAC-GCGGGUUCGACUCCCGC-CGCCUCCACCA Dps1t1
Sac4t1      GGGGGCG-----UUACGGU--UUCGACGGGGAUAGU-----UGAAGCUGUAGAAGCGUAC--CGAGG-UUCCUACAG-GCCUCGUUAAACAG--------GUAGGAA----AACAAUACUCGCAAACGAC---UAC------------------------------------------------------GAGUACGCAUUAGCCGCUUAG---------------------UCGGCUAA-------------------------------CGUUCUUUCUGAUUU-----------------UUCCUGUCGGAUCAGAGGGGGCG-------------------------------------------------------UAAUUUCA---GGCAGGA---UAGUCCUAACCUUU----------UCCUGUGGGGAACAGGGCGAAAUUCA-----CAUGGGAUA-----GCAAUCAGUAAAGCCUGCCU-UUG-GGCGUUACAGAGUGC-----GAAUGACAAAA--CAA-AGGAUACGUA-CGUAG-----------------------AAACUGCAGUGG-----AAUAUUUUCGGAC-GCGGGUUCGACUCCCGC-CGCCUCCACCA Sac4t1
Gsu3t3      GGGGGUG-----UACAGGU--UUCGACGGGGAUAGG------AAGCUGAUGGUUGCAUGC--CGAGG-UCCGGGCUG-GCCUCGUUAAAA----------AGCCCGGG--GCGAAUUACACGCCGAUAAU---UAC------------------------------------------------------GACUACGCUGUAGCAGCUUAA---------------------UAACCUGCUAC----------------------------CGAUCCGCUGAGCCU------------------CUCCCACGGGUGAAGAUGGAUCG------------------------------------------------------UCAUUUUA-GUGGGAUA----GUUGCGGGGAGGG-------------UCCAC--GGCCCCAAGGCGAAACCUUAGUGGA---AUC-----GCUUCCCGGAAAUCCCUGCCAGGGGAGAG--UCGGGCGGC-----UAAAUCAAA----UCCUGGUAUAAGCA-UGUAG----------------------ACGCCUUCGGUGU-----AUGAUCUUCGGAC-GCGGGUUCGACUCCCGC-CACCUCCACCA Gsu3t3
Gme1t2      GGGGGUG-----UACAGGU--UUCGACGGGGAUAGG------AAACUAAAGGUUGCAUGC--CGAGG-UCCGGGCUG-GCCUCGUUAAAA----------AGCCCGGG--GCGAAUUACACGCCGAUAAU---UAC------------------------------------------------------GACUACGCCGUAGCAGCUUAA---------------------UACCCUGCUAC----------------------------CGAUCCGCCGAGCCU------------------CUCCCACGGGUGAAGAUGGAUCG------------------------------------------------------UUAUUUCA-GUGGGAUA----GUCAAGGGGAGUG-------------CCCGC--GGCCCCAAGGCGAAACUUUAGCAGG---AUC-----GCUUCCCGGAAAUCCCUGCCAGGGGAGAG--UCGGGCGGC-----UAAAUCAAA----UCCUGGCAUAAGCA-UGUAG----------------------ACGCCUUCUGUGU-----AUGAUCUUCGGAC-GCGGGUUCGACUCCCGC-CACCUCCACCA Gme1t2
Dac7t1      GGGGGCG-----CCAAGGU--UUCGACGGGGAUUG-------GAAGCUAAGGUUGCAUGU--CGGAG---UGGGCAG-GCUCCGUUAAAA----------AGCCCAU---CUUAUACAAACGCCGAUACUGACGUU------------------------------------------------------UCGUACGCACUGGCAGCUUAA---------------------GUCUGCCA-------------------------------CGUCUCUAGUCUCUU---------------CGCCUGCGGGUUUCUAGCGACG----------------------------------------------------------UCAA-----UUUAGUAGG---CUGGUUGUUGUUCAA-------GUCCGUGGUUCAACA--GCGAGAUCUAA------ACGGAAUC----GCCACAUGUAAGAGCCUGUCU-GUG-GGGGCUGCAUGCGGU-----UAAAUUUAAAA--CAC-AGACUACACA-UGUAG----------------------ACGCCUUAAGUGA-----AAGAUUUUCGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Dac7t1
Bma1t1      GGGGGUG-----CCCUGGU--UUCGACGGGUUGCUA------GAAGUUUUGUGGGCGUGU-CCAGGCUGGUGUCCAAGGUCCUGGUUAAAA---------GGAGACC---AAACCAUAAUUGCAGAAUCUAAUUUU------------------------------------------------------GCUCCAGCUAUGGCCGCUUAA---------------------UUUAAUUAACGCCG-------------------------CCGCUUUAAGUAGCU------------------UGAGGGGUUAGCAUCCAAUAAAC------------------------------------------------------AGAAGCUAACAUCCCAGU---GGUAACAACUGGCUAACUUGUUACGCAGC-AACUGCCAUGCAAUGCUGUUGAAAAAACAAGUGGGGUUUGUCGAGUUCGCGUAAUUCGAACAGUCUUGUCUUCUGACGA-----UAAAU----------GAAGACUACGCA-CGUAG----------------------UCCGCACUAUGGA-----AAUCAACUCGGAC-GCGGGUUCGAUUCCCGC-CACCUCCACCA Bma1t1
Bba4t2      GGGGGCG-----UACUGGC--UUCGACGUGGGUGCU------GAAGCAUAAGGAGCAUAC--CGGGG-CGGAUGAGGA-CCUCGUUAAAAA-----------CGUCC---ACUUUGUAAUUGGCAAC---------------------------------------------------------------GAUUACGCACUUGCAGCUUAA---------------------UUAAGCAGC------------------------------ACGAUCAACCUUGUGGU-----------------GGUUCCGCACUUGGAUUGAUCGU------------------------------------------------------CAUUUA---GGGACCUC---GGCGUGUUGGGUU-----------UUCUCCAG--CAGACAUGCUUAAAUUUA--CUGGGGGAGA------GGUCUUAGGGAUUUUGUCU-GUG-GAAG-CCCGAGGACC-----AAUCUAAAA----CAC-UGACUAAGUA-UGUAG----------------------CGCCUUAUCGUGG-----AUCAUUUGCGGAC-GGGGGUUCAAUUCCCCC-CGCCUCCACCA Bba4t2
Mxa1t4      GGGGGCG-----ACCUGGU--UUCGACGGGGGCAUU------GAAGUUCGAGACGCGUGC--CGAGC-UUGUCAGGU-AGCUCGUAAAUUCAA-------CCCGGCAA---AGACACAAAAGCCAACGACAACGUU------------------------------------------------------GAGCUCGCGCUGGCUGCCUAA---------------------AAACAGCCCAUAGUGCG----------------------CGGUCCCCCCGCCCU-----------------CGGCCUGUGGGGUUGGGACAG-------------------------------------------------------ACCGUCAUAAUGCAGGCUG----GCUGCCGAGGGUG-------------CCUGG-ACCCGAGGUGGCGAGAUCUUCCCAGG----AC-----CGGCUCUGAGUAUCCCGUCC-GUG-GGAGCCUCAGGGACG------UAGCAAAU----CGC-GGACUACGCA-CGUAG----------------------GGUCGAAGAGCGG-----ACGGCUUUCGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACug Mxa1t4
Epsilonproteobacteria
Wsu2t2      GGGGUCG-----ACUUGGA-UUUCGACGGGAGCUAA------AUAGCCUCGGUUGCAUGU--CGGC--AUGGGCAC----GCCGUAAAA-----------CUACCCG--CAAUCAAUAAACGCAAACAACGCAAAC---------------------------------------------UACGCUCCCGCUUACGCCAAAGCUGCGUAA---------------------GUCUA--ACUCUUCGGAGC--------------------CGUCAAGCCUCACAAU---------------GCUAACUAGUGGGGAUUUGGCG---------------------------------------------------------UAACUUU---GUUAGCCGC--UCUCUCGUCUC--------------AUCCGAAGCGAGGGAA-----AAGA---UUAGGAU-UGCCCAUCACUUCCGCCU--------UGGGG--GCUUGAGCAAAGCGAUGG-AAAGAGCUUUCAA--CCCCAUCUAAGCA-UGUAG-------------------------AGACUGGGGUGGGUUUGG-CUUUCGGAC-UGGGGUUCGAUUCCCCA-CGACUCCACCA Wsu2t2
Cla2t1      GGGGACG-----ACUUGGC--UUCGACAGGAGUAGA------GUGGCCUUGGUGGCAUGU--CGCUU--UGAGC----AAAGCGUAAAAA----------GCUCAAA--UUAAAAUUAAACGCAAACAACGUUAAA---------------------------------------------UUCGCUCCUGCUUAUGCUAAAGCUGCGUAA---------------------GUU------CAGUU-GAGC--------------------CUGAAUUUUAAGUG---------------AUACUAUCUAGCUUAGAAUUUGG----------------------------------------------------------UCAUUUUU-GAUAGUGUA---GAUUGAAAUU----------------UGAC-AAAUUUUAAUU--GAAA--UUAAA--GUC-UUA---GUCUAGCUU-GAAAUUUUGGAAGGUGAGUUUGGCUAGAU-------GAAUUUU-----UCACCUUUGCUAAGCA-UGUAG-----------------------AUGCCGUGGUUGUU----UUAUUUUUGGAC-AGGGGUUCAAUUCCCCU-CGUCUCCACCA Cla2t1
Cfe1t22     GGGGGUG-----ACUUGGC--UUCGACAGGAGUAGU------GGAGUCACGGCGGCAUGC--AGCUU--UGGGC----AAAGCUUAAAAA----------GCCCAAA--AUAAAAUUAAACGCAAACAACGUUAAA---------------------------------------------UUCGCUCCUGCUUACGCUAAAGCUGCGUAA---------------------GUC------CAGUU-GAGC--------------------CCUGCGAAACUUCA---------------AUGCUAUCUAGAAGCUUUAGCGGG---------------------------------------------------------UAAUUUUU-GAUAGCUUA---GAUUAAAGAAU---------------UGAC-GAAUCUAUAAUU-GAAA--UUUA---GUC-UUA---GCUUAGCUA-AACGCUUUGGGAAGUGAGCGAAGCUAAGU-------GAAACUC-----UCACUUCUGCUAAGCA-UGUAG-----------------------AGGCUAUGAAUCUA----UUAUUUUUGGAC-UGCAGUUCGAUCCUGCA-CACCUCCACCA Cfe1t22
Cfe1t24     NNNNNNN-----NNNNNNN--NNNNNNAGGAGUAAG------UCUGCUUAGAUGGCAUGU--CGCUU--UGGGC----AAAGCGUAAAAA----------GCCCAAA---UAAAAUUAAACGCAAACAACGUUAAA---------------------------------------------UUCGCUCCUGCUUACGCUAAAGCUGCGUAA---------------------GUU------CAGUU-GAGC--------------------CUGAAAUUUAAGUC---------------AUACUAUCUAGCUUAAUUUUCGG----------------------------------------------------------UCAUCUUU-GAUAGUGUA---GCCUUGCGUU----------------UGAC-AAGCGUUGAGGU-GAAA--UAAA---GUC-UUA---GCCUUGCUUUUGAGUUUUGGAAGAUGAGCGAAGUAGGGU-------GAAGUAG-----UCAUCUUUGCUAAGCA-UGUAG-----------------------AGGUCUUUGUGGGA----UUAUUUUUGGNN-NNNNNNNNNNNNNNNNN-NNNNNNNNNNN Cfe1t24
Cje1t37     GGGAGCG-----ACUUGGC--UUCGACAGGAGUAAG------UCUGCUUAGAUGGCAUGU--CGCUU--UGGGC----AAAGCGUAAAAA----------GCCCAAA---UAAAAUUAAACGCAAACAACGUUAAA---------------------------------------------UUCGCUCCUGCUUACGCUAAAGCUGCGUAA---------------------GUU------CAGUU-GAGC--------------------CUGAAAUUUAAGUC---------------AUACUAUCUAGCUUAAUUUUCGG----------------------------------------------------------UCAUUUUU-GAUAGUGUA---GCCUUGCGUU----------------UGAC-AAGCGUUGAGGU-GAAA--UAAA---GUC-UUA---GCCUUGCUUUUGAGUUUUGGAAGAUGAGCGAAGUAGGGU-------GAAGUAG-----UCAUCUUUGCUAAGCA-UGUAG-----------------------AGGUCUUUGUGGGA----UUAUUUUUGGAC-AGGGGUUCGAUUCCCCU-CGCUUCCACCA Cje1t37
Hpy1t2      NNNNNNN-----NNNNNNN-NNNNNNNAGAUUUCUU------GUCGCGCAGAUAGCAUGC--CAAG---CGCUG------CUUGUAAAA-------------CAGCA--ACAAAAAUAACUGUAAACAACACAGAU---------------------------------------------UACGCUCCAGCUUACGCUAAAGCUGCGUGA---------------------GUUAAUCUCCUUUUGGAGC--------------------UGGACUGAUUAGAAU-----------------UUCUAGCGUUUUAAUCGCUCCA--------------------------------------------------------UAACCUUAA-GCUAGACGC--UUUUAAAAGGUG--------------GUUC--GCCUUUUAAAC--UAAGAAACAA-GAAC--UCUUGAAACUAUCUUAAGGUUUUAGAAAGUUGGACCAGAGCUAGUUUUAAGGCUAAAAA-CUAACCAAUUUUCUAAGCAUUGUAG----------------------AAGUUUGUGUUU-AGGGCAAGAUUUUUGGAC-UGGGNNNNNNNNNNNNN-NNNNNNNNNNN Hpy1t2
Hpy9t8      GGGGCUG-----ACUUGGA-UUUCGACAGAUUUCUU------GUCGCACAGAUAGCAUGC--CAAG---CGCUG------CUUGUAAAA-------------CAGCA--ACAAAAAUAACUGUAAACAACACAGAU---------------------------------------------UACGCUCCAGCUUACGCUAAAGCUGCGUGA---------------------GUUAAUCUCCUUUUGGAGC--------------------UGGACUGAUUAGAAU-----------------UUCUAGCGUUUUAAUCGCUCCA--------------------------------------------------------UAACCUUAA-GCUAGACGC--UUUUAAAAGGUG--------------GUUC--GCCUUUUAAAC--UAAGAAACAA-GAAC--UCUUGAAACUAUCUCAAGGUUUUAGAAAGUUGGACCAGAGCUAGUUUUAAGGCUAAAAAACCAACCAAUUUUCUAAGCAUUGUAG----------------------AAGUUUGUGUUU-AGGGCAAGAUUUUUGGAC-UGGGGUUCGAUUCCCCA-CAGCUCCACCA Hpy9t8
Hpy40t3     GGGGCUG-----ACUUGGA-UUUCGACAGAUUUCUU------GUCGCACAGAUAGCAUGC--CAAG---CGCUG------CUUGUAAAA-------------CAGCA--ACAAAAAUAACUGUAAACAACGCAGAU---------------------------------------------UACGCUCCAGCUUACGCUAAAGCUGCGUGA---------------------GUUAAUCUCCUUUUGGAGC--------------------UGGACUGAUUAGAAU-----------------UUCUAGCGUUUUAAUCGCUCCA--------------------------------------------------------UAACCUUAA-GCUAGACGC--UUUUAAAAGGUG--------------GUUC--GCCUUUUAAAC--UAAGAAACAA-GAAC--UCUUGAAACUAUCUCAAGGUUUUAGAAAGUUGGACCAGAACUAGUUUUAAGGCUAAAAAGCUAAUCAAUUUUCUAAGCAUUGUAG----------------------AAGUUUGUGUUU-AGGACAAGAUUUUUGGAC-UGGGGUUCGAUUCCCCA-CAGCUCCACCA Hpy40t3
Hmu3t2      GGGGCUG-----AUUUGGC-UUUCGACAGGAAUUGU------AUCGCUUGGAUUGCAUGU--CGGUA--GGCA------UACCGUAAUCC------------UGCCA-GCUUAAAUUAAACGCAAACAACAAAAAU---------------------------------------------UACGCUCCAGCUUACGCAAAAGUAGCGUAG--------------------GUUUAUCUCUGUUUUGGAGC--------------------CGAUCUUUUUGCCAU------------------AUCUACUAACAAAAAAGGUCG--------------------------------------------------------UUAUUUC---GUAGGUU----GCGCUUUUUUGU---------------GUCAUCAAAAAAGCAA--AGAUAA------GAC-UGCUUGCCUGCAAAAGAUUU-----UGAAAGUUG---AAUCUAGCGGGCAA-AAAGAUUA---UUCAACUUUGCUAAGCA-UGUAG------------------------AGAUCCUUGU-AGAUAUAA-UUUUUGGAC-UGGGGUUCGAUCCCCCA-CAGCUCCACCA Hmu3t2
Hhe2t2      GGGGCUG------AUUGGC-UUUCGACAGGAGCAAA-------GAGACUUAAGUGCAUGU--GAGC---UGGUAA-----GCUCUAAAA-----------CUACCAC--AAAUAAAUAAACGCAAACAACGCAAAU---------------------------------------------UACGCUCCAGCUUACGCAAAAGUCGCGUAA--------------------GUUUAUCACACUUUUGGAGU--------------------CGGCUUAAGAACUUCUAA---------------UCUAGCUAGAAUCUUUCAAGCUG------------------------------------------------------UAAUCUUU--GCUAGAU----GCUCUUUUUGUCAU------------ACCUUAGCAAAAAGAA----AAGAA---UAAGGU-UGCUUGUGGGAUUUAUCU--------UGGGGUGU----UGGAUAACCACGA-----AAAGAAAACAAUACCUACUAAACA-UGUAG------------------------AUUCUUAAGA-AGCUCAAG-CUUUUGGAC-UGGGGUUCAACUCCCCA-CAGCUCCACCA Hhe2t2
GRAM-POSITIVES
FIRMICUTES: Clostridia
Cac3t3      GGGGGCG----CUUUUGGU--UUCGACGGGGAUGAU----GUUACGUUUGAGAAGCGAGU--CGAGGGAACCUGUGGA-CCCGCGUUAAAAAA-------CUAUAGGCCUUAAAAAUAAAGGAUAACGAAAAUAAU---------------------------------------------------------UUAGCUUUAGCUGCGUAG--------------------------UCAGCUAA--------------------------CGUCAG--CCUGAGAG------------------UCCCGC-GACUCAGAGU-CUGGCGUCGACA-------------------------------------------------------GCGGGGAA-----CCGAGCCUUACAA---------AGCUUUGAGUAAGGAACGG--AAUUUA-----UGAAGCUA--------CUGAAGUGAAAAGCUUGUUUGUAGGCGUUUCAUGGAGG---GAAUGUUAAAA----UAC-AAACUGCACU-CGGAG-----------------------AUGCUUAAAUG----AAACCAUUUUCGGAC-AGGGGUUCGAUUCCCCU-CGCCUCCACua Cac3t3
Cpe3t6      GGGGGCG-----UUUUGGC--UUCGACGGGGGUAA-----GAUGGGUUUGAUAAGCGAGU--CGAGGGA-AGCAUGGU-GCCUCGAUAAUAAA-------GUAUGCA--UUAAAGAUAAACGCAGAAGAU---AAU---------------------------------------------------------UUUGCAUUAGCAGCUUAA--------------------UUUAGCGCUGCU----------------------------CAUCCUU-CCUCAAUU------------------GCCCAC-GGUUGAGAGUAAGGGUGUCAUUUAAAA---------------------------------------------------GUGGGGAA-----CCGAGCCUAGCAA---------AGCUUUGAGCUAGGAACGG--AAUUUA-----UGAAGCUUA-------CCAAAGAGGAA-GUUUGUCUGUGGACG-UUCUCUGAGG---GAAUUUUAAAA----CACAAGACUACACU-CGUAG-----------------------AAAGUCUUACU----GGUCUGCUUUCGGAC-ACGGGUUCGACACCCGU-CGCCUCCACCA Cpe3t6
Cpe11t6     GGGGGCG-----UUUUGGC--UUCGACGGGGGUAA-----GAUGGGUUUGAUAAGCGAGU--CGAGGGA-AGCAUGGU-GCCUCGAUAAUAAA-------GUAUGCA--UUAAAGAUAAACGCAGAAGAU---AAU---------------------------------------------------------UUUGCAUUAGCAGCUUAA--------------------UUUAGCGCUGCU----------------------------CAUCCUU-CCUCAAUU------------------GCCCAC-GGUUGAGAGUAAGGGUGUCAUUUAAAA---------------------------------------------------GUGGGGAA-----CCGAGCCUAGCAA---------AGCUUUGAGCUAGGAACGG--AAUUUA-----UGAAGCUUA-------CCAAAGAGAAA-GUUUGUCUGUGGACG-UUCUCUGAGG---GAAUUUUAAAA----CACAAGACUACACU-CGUAG-----------------------AAAGUCUUACU----GGUCUGCUUUCGGAC-ACGGGUUCGACACCCGU-CGCCUCCACCA Cpe11t6
Cth5t6      GGGGGCG-----UAUUGGU--UUCGACGGGAUUGU------UGAAGCUUGAGUAGCGGGU--AGAGGA-UUCUCGUUG-GCCUCUUUAAAA---------AACGAGAA-ACUAAAAUAAACGCUAACGAAGAUAAU------------------------------------------------------UACGCUUUAGCUGCUGCCUAA---------------------UAUAGGCAGC-----------------------------CCGUCAG-UCCAGGGU------------------UCCUGC-GCCUUGGGUAGCUGGCGUCAUUAAGU-------------------------------CAGGCCUUUUGAGUGGGAAGGUUAAACUCUAGAACUGU-CACAGUGGU--------AGCCUUGAGCUGUG-AUGG--AUUUUA------AAGGCUA--------CUGAUAUCCAAAGCCUGCCCAUGGGCGUUGGGUUGAGG---GAAUUUUUAAAA---CAU-GGGCUGCACC-CGGAG-----------------------AAGCUCUUGUG----GAUACGAUUUCGGAC-AGGGGUUCGACUCCCCU-CGCCUCCACCA Cth5t6
Cbo1t1      GGGGGCG-----CAAUGGU--UUCGACGGGGGCAAA-----UUGCUCCUGGGAAGCGAGU--CGAAGGG-AUCCUGUA-CCUGCGUUAAAAAA-------CUGGGAA-CUUAAAUAUAAUUGCAAACGAU---AAU---------------------------------------------------------UUUGCAUUAGCUGCCUAA---------------------UAGUUGCAGCU----------------------------CGUCAG--CCUAAGAG------------------UCCCAC-GACUUAGGGU-CUGGCGUCGACA-------------------------------------------------------GUGGGGAA-----CCGAGUCUUACAA---------AGCUUUGAGUAAGGAACGG--AAUUAA-----UGAAGCUA--------CUGAAUCUAGGAGCCUGUUUAUCGGCGCUUAGAGGAGG---GAAUGUAAAAG----GAU-AAACUGCACU-CGGAG-----------------------AUGCCCAGGGG----UUGCUGCUUUCGGAC-AGGGGUUCGAUUCCCCU-CGCCUCCACCA Cbo1t1
Cte3t1      GGGGGCG----UAAAUGGU--UUCGACGGGGGCAAG-----UUGCUCCUGAGAAGCGAGU--CGAGGGG--UCCUGGG-CCCGCGUUAAAAAA-------CUGGGAA---AAAUUAUAAACGCAGACGAU---AAU---------------------------------------------------------UUCGUUUUAGCUGCCUAA---------------------UUAGUGCAGCU----------------------------CGUCCUA-CUUGGGAG------------------UCCCAC-GACCUAAGAU-AGGGCGUCAAUUA------------------------------------------------------GUGGGGAA-----CCGAGCUCUACAA---------AGCUUUGAGUAGAGAACGG--AACUUA-----UGAAGCUA--------CUGAAUCUAGAAACCUGUUUAUCGGUGUCUAGAGGAGG---GAAUGUUAAAA----GGU-AAACUGCACU-CGGAG-----------------------AUGCUCAGGGG----UUACUGCUUUCGGAC-AGGGGUUCGAUUCCCCU-CGCCUCCACCA Cte3t1
Cdi4t9      GGGGGCG-----UAAAGGU--UUCGACGUGGGUUU------GGAACUUGAGGCUGCAUGU--CGUGUUA--CUCUGG--GUCACGUAAAAA---------CUGGGGAACUUUAAAAUAAACGCAGACGAU---AAU---------------------------------------------------------UUCGCGAUAGCAGCCUAG------------------------UUGCUGCU----------------------------CGUCCC--UCUUAGUCC-----------------UCCUGCCGACUAAGACU--GGACGUCAUUAU------------------------------------------------------GCAGGGAA-----CUACUUUAGGGGU---------GUCUCGA--CUUGAAGUAG---AUUAA-----UUGGGACUG-------GCUAAGCAUAGAGCCUGCCACUUGGCGCUAUGUGAGGU---GAGAUAUUAGUG---AAGUUGGCUAAGCA-UGUAG-----------------------AUGCAGCAAGG----AAAAGAUUUGCGGAC-AGGGGUUCGACUCCCCU-CGUCUCCACCA Cdi4t9
Cdi23t19    GGGGGCG-----UAAAGGU--UUCGACGUGGGUUU------GGAACUUGAGGCUGCAUGU--CGUGUUA--CUCUGG--GUCACGUAAAAA---------CUGGGGAACUUUAAAAUAAACGCAGACGAU---AAU---------------------------------------------------------UUCGCGAUAGCAGCCUAG------------------------UUGCUGCU----------------------------CGUCCC--UCUUAGUCC-----------------UCCUGCCGACUAAGACU--GGACGUCAUUAU------------------------------------------------------GCAGGGAA-----CUACUUUAGGGGU---------GUCUCGA--CCUGAAGUAG---AUUAA-----UUGGGACUG-------GCUAAGCAUAGAGCCUGCCACUUGGCGCUAUGUGAGGU---GAGAUAUUAGUG---AAGUUGGCUAAGCA-UGUAG-----------------------AUGCAGCAAGG----AAAAGAUUUGCGGAC-AGGGGUUCGACUCCCCU-CGUCUCCACCA Cdi23t19
Csa1t1      GGGGGCG---UGUUUUGGAA-UUCGACGGGGGCAGU-----CGGAUUCCAAAUAGCGGGU--AGUGGU-UUUCUCGGU-ACCACUAUAAAAA-------ACCGAGAAG---AAAAAUAACUGCAGACAAAGCUGAA---------------------------------------------------------CUCGCUUUAGCUGCAUAA--------------------GAUAAGCAGCUAA---------------------------CGUCCGCCGGAGGUGCCCACG------------GCCUCCGAGUCGGGCGCCAACCCACG-------------------------------------------------------------UGGGGCA----CCGAAAGUAAGGUC---------GCCUGAGCCUUACUUUUGG--GUCAAAU----CUCAGGCUG--------GGGAAGAAAAAGCCUGUCAGUGGGCGUUUUCUUCCC----GAGAAUUUAAGUA---CACUGACUGCACC-CGGAG-----------------------AAGUUUGGAGU----UCGAUGCCUUCGGAC-GGGGGUUCAAAUCCCCC-CGCCUCCACCA Csa1t1
Chy2t1      GGGGGCG-----UAAAGGG--UUCGACGGGGGAGCG----AAGGGCCGAAAGUAGCGAGG--CGAGGAC-CCCAUCUU-ACCUCGUUAAAAAU--------GGUGGG---AAAAGAUAACUGCCAACGAA---AAC---------------------------------------------------------UACGCUUUAGCUGCUUAA----------------------UAACGCAGCUA---------------------------CGUCCUGACGGAAGCUU-----------------GCCCGG-GGCUUCUGUC-GGGGCGUGACCGGA-----------------------------------------------------CCGGGCUG----GCUUAUGAAGGGU-----------GUCCCGGCUCUUCAUAAGCGAGAUUUU----ACGGGAUA--------GCCCGAUUGUG-GCCUGCCGGUAGGCAC-CAAUCGGGU---GAAAGCAAAAA----UAC-CGGCUGCCCU-CGGAG-----------------------AAGCUUUCGGU----UCUUGUCCUCCGGACGGUGGGUUCGAUUCCC-CCCGCCUCCACCA Chy2t1
Hmo1t1      NNNNNNN-----NNNNNNN--NNNNNNGGGGAACGU-----GUUUGCUUGGGAUGCGAGC--CGGGU-UGCCGCCAGGA--CCGUAAAAAG---------GGCGG----AAGGCUUUAAUUGCCGAAGAUAAC------------------------------------------------------------UACGCUUUAGCUGCUUAA------------------UUGCAGUCGAA-------------------------------CCUCUUCUCCUCUGU------------------GCUCUCGGUGAGGAUGUAAGGGGUCAUUUAA-------------------------------------------------------GAGAGCUG----GCUUCGACCAAUUC----------UCGG--AGGUCC--AAGC--GAGAUUUA----UCGAA-UA------GCCUGACC--AACCUCUGUCUGCCGUGCGGAAGGAAGGC---GAAAUCUAAA----ACGACAGACUACGCU-CGUAG-----------------------UGUCCUUUGUG----GGCAUUUCUUCGGAC-GCGGNNNNNNNNNNNNN-NNNNNNNNNNN Hmo1t1
Tte1t2      GGGGGUG-----UGUUGGU--UUCGACGGGGGCGG-----UCGAGGUAAAAGUAGCGAGC--CGAGUU--CUCCACC--AGCUCGUAAAAAA--------GGUGGA----AAAAAAUAAACGCAGACAGAGAA------------------------------------------------------------CUCGCUUACGCUGCCUAA---------------------UUAAAGGCGGC----------------------------CGUCCAG-CCUGAAAU------------------GCCCAC-GUUUCAGGA-CUGGGCGUCAAAAGA-----------------------------------------------------GUGGGGAA-----CUGGUUUUGCCUG---------CGCCUCGGGGCAAAACCGG--AAUAA------UGAGGCUA--------CCGAAGCGGUUAUCCUGUCGCUGGGAGAACCGCUGAGG---GAAAGCUAAAA----CAG-CGACUGCGCU-CGGAG-----------------------AAGCUUUUACC----GGGACGCCUUCGGAC-CGGGGUUCGAAUCCCCG-CACCUCCACCA Tte1t2
Cpr1t1      GGGGGCG-----AAAAGGU--CUCGACGGCGAGUC------GGAGCCUUGAGCUGCAGGC--AGGG--UUGGCUGCCAC--ACCUUAAAAAG--------GGUAGCAAGGCAAAAAUAAAUGCCGAACCAGAA------------------------------------------------------------UUUGCACUAGCUGCUUAA----------------------UGUAAGCAGC----------------------------CGCUCUCCAAACUGAG------------------GCUGCA-UAAGUUUGG-AAGAGCGUCAACCCA-----------------------------------------------------UGCAGCGG-----CUCUUAAGCAGUG----------GCACCAGCUGUUUAAGGG--UGAAAAGAG--UGGUGCUG--------GGCAGUGCG--GUUGGGCUUCCUGGGC--UGCACUGUC---GAGACUUCACA-----GGAGGGCUAAGCC-UGUAG-----------------------ACGCGAAAGGU----GGCGGCUCGUCGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Cpr1t1
Mth1t1      GGGGGCG-----UAAUGGU--UUCGACGGGGGUAG-----CAUUGGCAGUAGUAGCCAGG--CGAG---AUCCCACCGG--CUCGUUAAA---------CGGUGGA--ACGGCUAUUAAGUGCCGACGAUAAU------------------------------------------------------------UUAGCUCUGGCUGCUUAA-------------------UUAAAAAGUAGCC----------------------------CAUCCGU-CUGGUCCUG-----------------GCCUGCGGGGACCAGUACCGGGUGUCAAAUCUA---------------------------------------------------GCAGGCUA------CCGGCAAGGCCCC----------GGCCCGGGGGCCUGAAGG--GAAUCUCAAG-CGGGCUGG--------CCCGAGGGU--AUCCGGUUUCCGGGAG-ACCCGACGGC---GAGAUUGAAAA-----CGGAAACUAUCCU-GGUAG-----------------------AAGCUACUGUG----GAUGUACCUUCGGAC-GGGGGUUCGACUCCCCC-CGCCUCCACCA Mth1t1
FIRMICUTES: Mollicutes
Mfl1t1      GGGGAUG-----UCCUGGU--UUCGACAGGAUACUC-----UGGUCAUAUAAUAGCA-GU--GGUGUGGUAGACCAUA--AUACUUCUA-----------GGUUUG--------AUAAAAUGCAAACAAAAACGAA---------GAAAACACAAACGAAGUUCCAACAUUUAUGUUAAAUGCUGGACAAGCAAAUUACGCUUUCGCUUAA------------------------UUUGACUUAAAU------------------------ACAAAUAUACGUUUGGCAAUUUUUAAUAGUC--UUGGAAU-CUGUUAAUUAUUGU-ACAUACCA------------------------------------------------------AUUCCAAUA------GAAAUUAUGA----------UCGUAAUAAAUAAUUUU-----GAAACUCA--AUUACGGAUG------UUAUAUUAGUCUUUUGAUAAUUUUAUUUAAUAUAG-------CAAAUUAG------AAAAUUAUCUAAAC--UGUAG-----------------------AAUUUAUAUGA----UUCGGUAUUUUGGAC-GUGGGUUCGAUUCCCAC-CAUCUCCACCA Mfl1t1
Sku1t1      GGGGAUG-----UUCCGGU--UUCGACAGGAAUGAU------CUACUAAUAUUGGCA-GU--AGU---UUAGUAG-------ACUAUAAUG---------CUACUAG--GUUUGAAGAAACGCAAGCAAAAAACAA---AAAGAAGACAAAAUUGAAAUGCCAGCUUUUAUGAUGAACAAUCAAUUAGCAGUAUCAAUGUUAGCAGCUUAA-----------------------UUCCUCGCUGUUAGAGGAUCGCUAGCCGUA-------AUAGUAGUUAAUUG-------------------UAGAUUA-UUAACUAUUAUCG-UAUCUCAAGUCU---------------------------------------------------UAAUCUAAUA----GAAAUUCUAAUU----------GAUAAUGUUAGAAUUUU--GAAAGUCU----UAUUAUCUA--------AUUAUUUAAUUAGUUGUCUAAUCCUAUUAUUAAAUAAU-GAAAAAAAGAU------GAUUAGACUAAAC--UGUAG-----------------------AAGAUAUUAGA----AUGUUAUUUGUGGAC-GCGGGUUCAAUUCCCGC-CAUCUCCACCA Sku1t1
Mca20t3     GGGGAUG-----UCAUGGA--UUUGACAGGAUAUCU-----UUAGUACAUAUAAGCA-GU--AGUGUUGUAGACUAUA-AAUACUACUA-----------GGUUUA--------AAAAAACGCAAAUAAAAACGAA------GAAACUUUUGAAAUGCCAGCAUUUAUGAUGAAUAAUGCAUCAGCUGGAGCAAACUUUAUGUUUGCUUAA------------------------UAACUACUAGUUUA----------------------GUUAUAGUAUUUCACGAAUUAUAGAUAUU----UUAAGCU-UUAUUUAUAACCG-UAUUACCCA------------------------------------------------------AGCUUAAUA------GAAUAUAUGA----------UUGCAAUAAAUAUAUUU-----GAAAUCUA--AUUGCAAAUG-------AUAUUUAACCUUUAGUUAAUUUUAGUUAAAUAU-------UUUAAUUAG------AAAAUUAACUAAAC--UGUAG-----------------------AAAGUAUGUAU----UAAUAUAUCUUGGAC-GCGAGUUCGAUUCUCGC-CAUCUCCACCA Mca20t3
Mmy3t2      GGGGAUG-----UCAUGGA--UUUGACAGGAUAUAA-----CCAGUACAUAUAAGCA-GU--AGUGUUGUAGACUAUA-AAUACUACUA-----------GGUUUG--------AAAAAACGCAGACAAAAACGAA------GAAAACUUUGAAAUGCCAGCAUUUAUGAUCAACAAUGCAUCAGCUGGAGCAAACUAUAUGUUUGCUUAA-----------------------UAACUACUUAGUUUA----------------------GUUAUAGUAUUUCACGCAUUAUAGAUAUU----UUAGGCU-UUAUUUAUAAUCG-UAUUACCCA------------------------------------------------------AGUCUAAUA------GGAUAUAUGA----------UUGCAAUAAAUAUAUCU-----GAAAUUA---AUUGCAAAUG-------GUAUUUAACCUUUAGUUAAUUUUAGUUAGAUAC-------UUUAAUUAG------AAAAUUAACUAAAC--UGUAG-----------------------AAAGUAUGUAU----UAGUGUAUCUUGGAC-GCGAGUUCGAUUCUCGC-CAUCUCCACCA Mmy3t2
Upa3t5      GGGGAUG-----UCACGGU--UUCGACGUGACACAU------UAAUUUUUAAUUGCA-GU--GGGG---UUAGC-------CCCUUAUC-----------GCUUUCGA-GGCAUUUUAAAUGCAGAAAAUAAAAAAUCUUCUGAAGUAGAAUUAAACCCAGCGUUUAUGGCUUCAGCUACUAAUGCAAACUACGCUUUUGCGUAC---UAA-----------------------UUAGUUAUUAGUAGAAAC-------------------GUUCAUUAACAUAAUU-----------------ACUAUUGGUUGGUUUUUGGGCUUAUUUUA---------------------------------------------------------CAAUAGU----UUUAAAUUUAAAAUUC-----UUAUUUGUUGUUUAAAUUUAAAUAGAUU---UAACAAAUAGU-------UAGUUAAUUUUAAAUUUGUUUUAUUAGUUAUUAACUA----CACUAUUUUU-------AAUAAAACUAAAC--UGUAG-----------------------AUAUUAUUAAU-----UAUGUGUUGCGGAA-AGGGGUUCGACUCCCCU-CAUCUCCACCA Upa3t5
Mpu2t2      GGGGAUG-----UAAUGGU--UUCGACAGGCAUUUA------UAACCUUAUAAUGCA-GU--AGUU---UGGCA-------GACUAUAA---------UGCUACUAGGCGUUUCAAUAAACGGAACAAAAAAACAA------GAAAAUGACUAUCAAGAUUUAAUGAUUAGUCAAAAUCUAAACCAAAAUCUAGCUUUUGCUAGCGUUUAG---------------------------CAGCUA---------------------------GUUGCUCCAUUAUAU--------------------GUUCUGGAUAAUGGAAGCA-UGCCUA----------------------------------------------------------AGAACUUAGU---GAAGUUG---------------CUCUAGCGUCAAUUUCAUGAAAUUUA-------GCUAGU-------UGAUUUAAUAGAAUUUUGUUCAAUUUUUUCUAUUAAAUCA--ACAAUUA-------AAAAUUGGAAUAAAC--UGUAG-----------------------AUUUAUAAGCA---UUGUGAAUGUGUGGAC-CCGGGUUCGACUCCCGG-CAUUUCCACCA Mpu2t2
Mmo4t1      GGGGGUG-----UAAUGGA--UUUGACAUGCAUAAG------GUUUAUUAGACUGCA-GU--ACUA---UGGUA-------GAGUAUAA-----------GACCACUAGGCUUUUUCAAACGGAAAAGAAAAACAA------------------UUAGAAGUUUCUCCUUUAUUAAUGAGUUCUUCACAAUCAAAUCUAGUUUUUGCUUAA--------------------------UUAAAAAUUAGU----------------------CGCUUCUAAGUGGU--------------------GUUGCUACAUUUAUAAGUG--UUGUUU----------------------------------------------------------AGCAAAUAUA---GUUUUAUGAU------------CUAAUUAAAUAAGAC--CGAAUAAAA------AAUUAGU-------UAAUAUAAAUGUUUUUAGUUAAGUUUCGAUUUUAUAUUA--AUAUCA----------AAAUUUAGCUAAAC--UGUAG-----------------------AUGUCUCUUAA----AUUUUAUGUGUGGAC-CCGGGUUCAACUCCCGG-CAUCUCCACCA Mmo4t1
Mhy12t2     NNNNNNN-----NNNNNNC--UUCGACAUACAUAAA------AGGAUAUAAAUUGCA-GU--GGUC---UUGUA-------AACCAUAA-----------GACAAUU--UCUUUACUAAGCGGAAAAGAAAACAAA------------AAAGAAGAUUAUUCAUUAUUAAUGAAUGCUUCAACUCAAUCAAAUCUAGCUUUUGCAUUUUAA---------------------------AAAACUAG-------------------------UAGACCAAUUUG---------------------CUUCUCACGAAUUGUAAUCUUUAUAUUA----------------------------------------------------------GAGAAUA------GUUAAAAAUC-------------UGAUCACUUUUUAAU--GAAUUUAUA------GAUCAC-----AGGCUUUUUUAAUCUUUUUGUUA-UUUUAGAUAAAGAGUCU----UCUUA----------AAAAUAACUAAAC--UGUAG-----------------------UAAUUUAUAUU----UAAUUAUGUGUGGAC-CCSGGUUCAACUCCCGG-VAUCUCCACCA Mhy12t2
Mpe3t1      GGGGAUG-----UCACGGU--UUCGACAUGAAUGGUU---GAUCUUCAAAUGCAGCA-GG--GUAA---GCCCU-------UUACAGCU----------GUCGAGGC------UAAUAAAUGCUAAGAACAAUAAAAACGAAGCUGUUGAAGUAGAAUUAAACGACUUUGAAAUCAACGCUUUAAGCCAAAACGCUAAUUUAGCUUUAUACGCUUAAUU----------------------------------------------------ACAUUUGGUAAUAAGUUCAUAUCUUUU--------UCUAGGUAGGUAUGAAUGUUUAAUAA----------------------------------------------------------CUAGAUA------GCUAAUUUAAU------------UCCUAUAACAAUUAGU-GAAGUUCGU-----UAGGAUUA-------CUUUUAUUUAUGGGUUGUUCUUUGCCUCUAUUUAAAAG--GACAUAUUAA------AGUUAGAACUAAGC--UGUAG-----------------------AUUUUGUCGCA----UUGCUAUUUGUGGAA-ACGGGUUCGACUCCCGU-CAUCUCCACCA Mpe3t1
Mar2t1      GGGGGUG-----UAAUGGC--UUCGACAGGCACUGG------AUUUAAUAAAUUGCA-GU--GGUU---GGU---------AACCUAAA-----------ACCAUCUAGGCUUUUUUAAACGGAAACUUAGAAACU---UCUGAAGACAAGAAACUUGAUCUUCAAUUUGUGAUGAACUCACAAACACAACAAAAUCUACUAUUUGCUUAA---------------------------UAAAUCGUAGU----------------------CAGGCGAAUAUAU--------------------UAGUUUCAAAUAUUUGCUUUG-UCGCUUA---------------------------------------------------------GGAACUA-----UGCCUUAACUAA------------AGUAGCUAAGUUAAGUG-UUAAAUAAUU---GCUACUCAA--------AUUUAUUGACAUUUGUUAAUUAGAUAAAUAAAUGGGU---CUUUCAC-------UUAAUUAACUAAAC-UUGUAG-----------------------ACAUUUAUUAA----UGAAAGUGUGUGGAC-CGGGGUUCGAUUCCCCG-CAUCUCCACCA Mar2t1
Mge2t10     GGGGAUG-----UUUUGGG--UUUGACAUAAUGCUGA----UAGACAAACAGUAGCA-UU--GGGG---UAUGC-------CCCUUACA-----------GCGCUAG---GUUCAAUAACCGACAAAGAAAAUAAC---------GAAGUGUUGGUAGAUCCAAAUUUGAUCAUUAACCAACAAGCAAGUGUUAACUUUGCUUUUGCAUAA-----------------------GUAGAUACUAAAGCU----------------------ACAGCUGGUGAAU--------------------AGUCAUAGUUUGCUAGCUGU-CAUAGUU---------------------------------------------------------UAUGACUC------GAGGUUAAAUC-------------GUUCAAUUUAACCUU-UAAAAAUA-------GAACUUG---------UUGUUUCCAUGAUUGUUUUGUGAUCAAUUGGAAACAA-GACAAAAAUC-------CACAAAACUAAAA--UGUAG-----------------------AAGCUGUUUGU---UGUGUCCUUUAUGGAA-ACGGGUUCGAUUCCCGU-CAUCUCCACCA Mge2t10
Mpn4t4      GGGGAUG-----UAGAGGU--UUUGACAUAAUGUUGA----AAGGAAAACAGUUGCA-GU--GGGG---UAUGC-------CCCUUACA-----------GCUCUAG---GUAUAAUAACCGACAAAAAUAACGAC---------GAAGUUUUGGUAGAUCCAAUGUUGAUCGCUAACCAACAAGCAAGUAUCAACUACGCUUUCGCUUAG------------------------AACAUACUAAAGCU----------------------ACACGAAUUGAAU--------------------CGCCAUAGUUUGGUUCGUGU-CACAGUU---------------------------------------------------------UAUGGCUC------GGGGUUAACUG-------------GUUCAACUUAAUCCU-UAAAUUAU-------GAACUUA---------UCGUUUACUUGUUUGUCUUAUGAUCUAAAGUAAGCGA-GACAUUAAAA-------CAUAAGACUAAAC--UGUAG-----------------------AAGCUGUUUUA---CCAAUCCUUUAUGGAA-ACGGGUUCGAUUCCCGU-CAUCUCCACCA Mpn4t4
Mga11t3     GGGGAUG-----UCAAGGC--UUCGACAUGAUUGAU------AAACUUAUUAGUUCA-GU--AGGG---UCUGC-------CCUUUAUA-----------GCUCAAGG--UAAUAAUAACCGACAAAACUUCUAAA---------GAACUAGCUGACGAAAACUUUGUUUUAAAUCAGUUAGCAUCAAACAACUACGCUUUAAACUUCUAA-----------------AUAAAUAAUAAAUAGCGUA-CUAGGUUUUUUAAAAACCUAGAUUUAUAGGAU--------------------------AAAACUAGAUUUUGUAA--CUC--------------------------------------------------------------GUUUUUA------GUUUUACUAUUAAUACUGAU-----UAAUUAGUUUUUUGA-CCCAACG-------AUUACUA---------CGAACCAAGAUGUUGAUACUUAUCA-CUUGGUUUG---AGCUUCA----------UAAGUAUCUAAAC--UGUAA-------------------AUAAAACUAAUUUGC---UGAGUCGAUUGUGGAA-ACGGGUUCGAUUCCCGU-CAUCUCCACCA Mga11t3
Oye1t1      GGGGAUG-----UUUUGGA--UUUGCCAGGUAACGA--------AAUUUAUAUAGCAUAU--CUUG---GUUACG------CAAGUAAAAA-----------CGUCGAGGUUAUAAUAACCGGAAAUAACAAACAAACUGUAACAAAUACACAAGAUUUUGCUGGACAAACUCCAGUUUAUCAAAUGAAUUUUGCAAACAGUUUUUCUUCACAAUUAGCUUUUGCUUAA-----AUAAAUAAGCAAAAA----------------------CCGCACUUAAAUUA--------------------ACUUACGAUUUAAGGAAGG-CAAUAAG-----------------------------------------------------------GUAAGU-----UUUGCUAAUUGGGUUU--------GUCUUUGCUCUUUUAGCAAAUAUCAA-----AAAGACUA-------GUAAUUUAUGGAUUUUGUUUGUUUUUUCAUAAAUUGC---GAACUUAC--------AAAAUAAACUAAAU-AUGUAG-----------------------AAUAUAUAAAU---UAAAGUGAUUUUGUAC-AUGGGUUCGACUCCCAU-CAUCUCCACCA Oye1t1
FIRMICUTES: Bacillales
Pla1t1      GGGGGCG----UUUUUGGA--UUCGACGGGGAUAGUUC----GA-GCAUGGGUAGCGGGU--AGUGG--GGACGCGU--CCGCUUUAUCA---------ACG-CUAACGCCAAAUUUAAACGGCAAACAACAAAAC------------------------------------------------------AACUACGCUUUAGCAGCUUAA------------------UAACCUGCUUGCGU----------------------------GCUCCUGCUUUGCAUC------------------GCCCAUGUGCCAAGUU-AGGGGCUCAACUUUA-----------------------------------------------------GUGGGCUAC--GCUGUCUAGUCUCC------------GCCUGAGGCUAG--CUGAAGAAGACAA---UCAGGC-UG----ACCUGUGAGAA--AGCCG-GUUACGGGGCGGGCUUACAGGU---GACAUUAAAA------CCGUGACUACACC-CGUAG-----------------------AAGCCUAUGUG----GCGUUAUCUUUGGAC-ACGGGUUCGACUCCCGU-CGCCUCCAuau Pla1t1
Pma2t1      NNNNNNN-----NNNNNNN--NNNNNNAGGGAUAGUUC----GA-GCUUAGGUUGCGAGU--CGAGG--GGAUCGG---CCUCGUUAAAA----------CG-UC---AAAGCCUAUAACUGGCAAACAACAAAAC------------------------------------------------------AACUUCGCUUUAGCUGCUUAA------------------UAGCGCUUAGCG------------------------------GUUCCUCCCUCCAUU-------------------GCCCAUGUGGUAGGGUAAGGGACUCACUUUAA-----------------------------------------------------GUGGGCUAC---GCCGGAUUCCACC------------GUCUGAGGAAGA--AGGAAGAGAACAA---CCAGAC-UA----GCUCAUCGGA---CGCCC-GUCAGCAGGCAGAAGAAUGAGC---GAAUCGCGAAUA----UGUUGACUACACU-CGUAG-----------------------AAGCUUAAGUG----CCGAUGUUUCUGGAC-GUGGNNNNNNNNNNNNN-NNNNNNNNNNN Pma2t1
Bce15t98    GGGGACG-----UUACGGA--UUCGACAGGGAUAGUUC----GA-GCUUAGGUUGCGAGU--CGAGG--GGAUCGG---CCUCGUUAAAA----------CG-UC---AAAGCCUAUAAUUGGCAAACAAAACAAU---------------------------------------------------------CUUUCUUUAGCUGCUUAA------------------UUGCACUAAAG-------------------------------GUUCCUCCCUCCAUC-------------------GUCCAUGUGGUAGGGUAAGGGACUCAAACUAA-----------------------------------------------------GUGGACUAC---GCCGGAGUUCGCC------------GUCUGAGGACAA--AGGAAGAGAACAA---CCAGAC-UA----GCAACUUGGA---AGCCU-GUCGAUAGGCCGAAGAGUUCGC---GAAAUGCUAAUA----UAUCGACUACACU-CGUAG-----------------------AAGCUUAAGUG----CCGAUAUUUUUGGAC-GUGGGUUCGACUCCCAC-CGUCUCCACCA Bce15t98
Bce15t98    NNNNNNN-----NNNNNNN--NNNNNNAGGGAUAGUUC----GA-GCUUAGGUUGCGAGU--CGAGG--GGAUCGG---CCUCGUUAAAA----------CG-UC---AAAGCCUAUAAUUGGCAAACAAAACAAU---------------------------------------------------------CUUUCUUUAGCUGCUUAA------------------UUGCACUAAAG-------------------------------GUUCCUCCCUCCAUC-------------------GUCCAUGUGGUAGGGUAAGGGACUCAAACUAA-----------------------------------------------------GUGGACUAC---GCCGGAGUUCGCC------------GUCUGAGGACAA--AGGAAGAGAACAA---CCAGAC-UA----GCAACUUGGA---AGCCU-GUCGAUAGGCCGAAGAGUUCGC---GAAAUGCUAAUA----UAUCGACUACACU-CGUAG-----------------------AAGCUUAAGUG----CCGAUAUUUUUGGAC-GUGGNNNNNNNNNNNNN-NNNNNNNNNNN Bce15t98
Bce51t18    GGGGACG-----UUACGGA--UUCGACAGGGAUAGUUC----GA-GCUUAGGUUGCGAGU--CGAGG--GGAUCGG---CCUCGUUAAAA----------CG-UC---AAAGCCUAUAAUUGGCAAACAAAACAAU---------------------------------------------------------CUUUCUUUAGCUGCUUAA------------------UUGCACUAAAG-------------------------------GUUCCUCCCUCCAUC-------------------GUCCAUGUGGUAGGGUAAGGGACUCAAACUAA-----------------------------------------------------GUGGACUAC---GCCGGAGUUCGCC------------GUCUGAGGACAA--AGGAAGAGAACAA---CCAGAC-UA----GCAACUUGGA---AGCCU-GUCGAUAGGCCGAAGAGUUCGC---GAAACGCUAAUA----UAUCGACUACACU-CGUAG-----------------------AAGCUUAAGUG----CCGAUAUUUUUGGAC-GUGGGUUCGACUCCCAC-CGUCUCCACCA Bce51t18
Bce15t98    GGGGACG-----UUACGGA--UUCGACAGGGAUAGUUC----GA-GCUUAGGUUGCGAGU--CGAGG--GGAUCGG---CCUCGUUAAAA----------CG-UC---AAAGCCUAUAAUUGGCAAACAAAACAAU---------------------------------------------------------CUUUCUUUAGCUGCUUAA------------------UUGCACUAAAG-------------------------------GUUCCUCCCUCCAUC-------------------GUCCAUGUGGUAGGGUAAGGGACUCAAACUAA-----------------------------------------------------GUGGACUAC---GCCGGAGUUCGCC------------GUCUGAGGACAA--AGGAAGAGAACAA---CCAGAC-UA----GCAACUUGGA---AGCCU-GUCGAUAGGCCGAAGAGUUCGC---GAAAUGCUAAUA----UAUCGACUACACU-CGUAG-----------------------AAGCUUAAGUG----CCGAUAUUUUUGGAC-GUGGGUUCGACUCCCAC-CGUCUCCACCA Bce15t98
Bce14t1     GGGGACG-----UUACGGA--UUCGACAGGGAUAGUUC----GA-GCUUAGGUUGCGAGU--CGAGG--GGAUCGG---CCUCGUUAAAA----------CG-UC---AAAGCCUAUAAUUGGCAAACAAAACAAU---------------------------------------------------------CUUUCUUUAGCUGCUUAA------------------UUGCACUAAAG-------------------------------GUUCCUCCCUCCAUC-------------------GUCCAUGUGGUAGGGUAAGGGACUCAAACUAA-----------------------------------------------------GUGGACUAC---GCCGGAGUUCGCC------------GUCUGAGGACAA--AGGAAGAGAACAA---CCAGAC-UA----GCAACUUGGA---AGCCU-GUCGAUAGGCUGAAGAGUUUGC---GAAAUGCUAAUA----UAUCGACUACACU-CGUAG-----------------------AAGCUUAAGUG----CCGAUAUUUUUGGAC-GUGGGUUCGACUCCCAC-CGUCUCCACCA Bce14t1
Bce51t18    GGGGACG-----UUACGGA--UUCGACAGGGAUAGUUC----GA-GCUUAGGUUGCGAGU--CGAGG--GGAUCGG---CCUCGUUAAAA----------CG-UC---AAAGCCUAUAAUUGGCAAACAAAACAAU---------------------------------------------------------CUUUCUUUAGCUGCUUAA------------------UUGCACUAAAG-------------------------------GUUCCUCCCUCCAUC-------------------GUCCAUGUGGUAGGGUAAGGGACUCAAACUAA-----------------------------------------------------GUGGACUAC---GCCGGAGUUCGCC------------GUCUGAGGACAA--AGGAAGAGAACAA---CCAGAC-UA----GCAACUUGGA---AGCCU-GUCGAUAGGCCGAAGAGUUCGC---GAAACGCUAAUA----UAUCGACUACACU-CGUAG-----------------------AAGCUUAAGUG----CCGAUAUUUUUGGAC-GUGGGUUCGACUCCCAC-CGUCUCCACCA Bce51t18
Bme1t1      NNNNNNN-----NNNNNNN--NNNNNNAGGG-UAGUUC----GA-GCUUAGGUUGCGAGU--CGAGG--AGAUGG----CCUCGUUAAAA-----------CAUCAACGCCAAUAAUAACUGGCAAAUCUAACAAU------------------------------------------------------AACUUCGCUUUAGCUGCAUAA------------------UAGUAGCUUAGC------------------------------GUUCCUCCCUCCAUC-------------------GCCCAUGUGGUAGGGUAAGGGACUCACUUUAA-----------------------------------------------------GUGGGCUAC---GCCGGAGUUCGCC------------GUCUGAGGACGA--AGGAAGAGAAUAA---UCAGAC-UA----GCGACUGGGA---CGCCU-GUUGGUAGGCAGAACAGCUCGC---GAAUGAUCAAUA----UGCCAACUACACU-CGUAG-----------------------ACGCUUAAGUG----GCCAUAUUUCUGGAC-GUGGNNNNNNNNNNNNN-NNNNNNNNNNN Bme1t1
Bha1t1      GGGGACG-----UUCUGGA--UUCGACAGGAAUAGGUC----GA-GCUUAAGUGGCGAGC--CGAGG--UGGCGA----ACUCGUUAAAA-----------CGCCA---UCGCCAAUAACUGGCAAAGAAAACAAC------------------------------------------------------AACUUCGCAUUAGCUGCCUAA------------------GCUAGCAAAUGCG-----------------------------GUUCCGCCCUCCAUC-------------------GCCCAUGUGGUAGGUGUCGGGACUCACUUUUA-----------------------------------------------------GUGGGCUAC---GCCUCUCACCCUCC-----------GUCUGUGGGUGA--AGGAAGAGAUUUA---UCAGAC-UA----GCCUUACGGA---AGCCU-GUCGCUGGGCUGAAGUAACGGC---GAAAUGCGAAUA----CAGUGACUACGCU-CGUAG-----------------------AAGCUUAAGUA---CUCGUUAUUUCUGGAC-GUGGGUUCGAUUCCCAC-CGUCUCCAuuu Bha1t1
Bcl1t1      GGGGACG-----UUUUGGA--UUCGACAGGGAUAGGUC----GA-GCUUGCGUUGCGAGC--CGAGG--GGUCGG----CCUCGUAAAAA-----------CGCAC---AAGCCAAUAACUGGCAAAGAAAACAAC------------------------------------------------------AACUUCGCUCUAGCUGCAUAA-----------------------GCUAAGCG-----------------------------GUCUCUCCUCUCCAUC------------------GCCCAUGUGGAGUGG-CUGAGACUCAACUUUA-----------------------------------------------------GUGGGAUAC---GCCUUUCUCCCCCC-----------GCCUGAGGGAGA--AGGAAGAGACUAA---UCAGGC-UA----GCUGCACGGA---GGCCU-GUCUUUGGGCUGAAGUGCUAGC---GAAAUACGAAUA----CAAAGACUACGCU-CGUAG-----------------------AAGCGUAAGUG----UCGUUAUCUCUGGAC-GUGGGUUCAAUUCCCAC-CGUCUCCAuau Bcl1t1
Bsu14t22    GGGGACG-----UUACGGA--UUCGACAGGGAUGGAUC----GA-GCUUGAGCUGCGAGC--CGAGA---GGCGA----UCUCGUAAACA-----------CGCA---CUUAAAUAUAACUGGCAAAACUAACAGU---------------------------------------------UUUAACCAAAACGUAGCAUUAGCUGCCUAA------------------UA--AGCGCAGCGA----------------------------GCUCUUCCUGACAUU-------------------GCCUAUGUGUC--UGUGAAGAGCACAUCCAA------------------------------------------------------GUAGGCUAC---GCUUGCGUUC-CC------------GUCUGAGAACG--UAAGAAGAGAUGAA----CAGAC-UA----GCUCUCGGAA---GGCCC-GCCCGCAGGCAAGAAGAUGAGU---GAAACCAUAAAUA---UGCAGGCUACGCU-CGUAG-----------------------ACGCUUAAGUA---AUCGAUGUUUCUGGAC-GUGGGUUCGACUCCCAC-CGUCUCCAuac Bsu14t22
Bli1t3      GGGGACG-----UUACGGA--UUCGACAGGGACGGAUC----GA-GCUUGAGCUGCGAGC--CGAGA---GGCGA----UCUCGUAAAAA-----------CGCA---CCUAAAUAUAACUGGCAAAUCUAACCAG------------------------------------------------------AACUUAGCACUAGCUGCCUAA------------------UU--AGCGCAGCGA----------------------------GCUCUUGCCCGCAUC-------------------GCCUAUGUGCC--GGUUAAGAGCCCAUAACGAA----------------------------------------------------GUAGGCUAC---GCUUGCGCCC-CC------------GUCUGAGGGCG--CAGGAAGAGACUCA---UCAGAC-UA----GCUCUCCUAG---GGCCC-GCCCGCAGGCACGAAGAUGAGC---GAAACUAAAUAU----GCAGGGCUACGCU-CGUAG-----------------------ACGCUGAAGCA---AUCGACGUUUCUGGAC-GUGGGUUCGACUCCCAC-CGUCUCCAucu Bli1t3
Gst1t3      GGGGACG-----AUCCGGA--UUCGACAGGGGUAGGUC----GA-GCUUAAGCGGCGAGC--CGAGG-GGGACGU----CCUCGUAAAA-----------ACGUC--ACCUAAAGAUAACUGGCAAACAAAAC------------------------------------------------------------UACGCUUUAGCUGCCUAA------------------UUG--CUGCAGCUA----------------------------GCUCCUCCCGCCAUC-------------------GCCCGCGUGGCGU-UCGAGGGGCUCAUAUGAA-----------------------------------------------------GCGGGCUAC---GCCCAAAUCCGCC------------GCCUGAGGAUGA--GGGAAGAGAUGAA---CCAGGC-UA----GCCGCCGGGA---GGCCU-GUCGGUAGGCGGAACGGACGGC---GAAGCG-AAAUA----UACCGACUACGCU-CGUAG-----------------------AUGCUUAAGUG----GCGAUGCCUCUGGAC-GUGGGUUCGACUCCCAC-CGUCUCCAuuu Gst1t3
Gka2t6      GGGGACG-----AUCCGGA--UUCGACAGGGGUAGGUC----GA-GCUUAAGCGGCGAGC--CGAGG-GGGACGU----CCUCGUAAAA-----------ACGUC--ACCUAAAGAUAACUGGCAAACAAAAC------------------------------------------------------------UACGCUUUAGCUGCCUAA------------------UUG--CUGCAGCUA----------------------------GCUCCUCCCGCCAUC-------------------GCCCGCGUGGCGU-UCGAGGGGCUCAUAUGAA-----------------------------------------------------GCGGGCUAC---GCCCAAAUCCGCC------------GCCUGAGGAUGA--GGGAAGAGACGAA---CCAGGC-UA----GCCGCCGGGA---GGCCU-GUCGGUAGGCGGAACGGACGGC---GAAGCG-AAAUA----UACCGACUACGCU-CGUAG-----------------------AUGCUUAAGUG----GCGAUGCCUCUGGAC-GUGGGUUCGACUCCCAC-CGUCUCCAuuu Gka2t6
Esi2t2      GGGGACG-----UUACGGA--UUCGACGGGGGUAGUUC----GG-UCUUCUGUGGCGUGU--CGAGG--GGUCGG----CCUCGUUAAAA----------CGCAUC-----AGCCAUAACUGGCAAAACUAAC---------------------------------------------------------ACACAACUCGCAGCAGCUUAA------------------UAGCUACUACG-------------------------------GAUCCUAGCAGCCGUC------------------GCCUGGUCGGCUGAUUUCUAGGGUCUCACUUUAA---------------------------------------------------ACAGGCUAC---GCUUGGACCCUUCC-----------GUCUGGAGGGAAA-GAGAAGAGAUGGAA--UCAGAC-UG----GUCGGACGGA---CGCCU-GUCAAUUGGCAGCCUGA-CGAC---GAGAUCCCAAUA----AAUUGACUACACA-CGUAG-----------------------AAGCUUAAGUA---UACGAUGCCUUCGGAC-GUGGGUUCGACUCCCAC-CGUCUCCAuac Esi2t2
Oih1t1      GGGGACG-----UUACGGA--UUCGACAGGGAUAGAUU----GA-GCUCAGGUUGCACGU--CGAGG---UUACG----GCUCGUAAAA-----------CGUU-AUGCCUAAAUAUAACUGGCAAAGAAACUAAU---------------------------------------------------CAACCUGUUUUAGCAGCUGCGUAA------------------GUAGCCUAAAAC------------------------------GAUCCUUCCUGGCAUC------------------GCCCGUGUGGCAGAUUGAAGGGUCUCAAAUUAA----------------------------------------------------GCGGGCUAU---GCUACGAUCCUCC------------GCCUGGGGAUUUG-UAGAUGAAUCUAA---UCAGGC-UA----GCUCCAUGAA---AGCCU-GUUGGUAGGCCAACAUGAGAGC---GAAUGAUAAUA-----UACCAACUACGCG-UGUAG-----------------------AAGCCUGAGUG----GCGAUAUCCUUGGAC-GAGGGUUCGACUCCCUC-CGUCUCCACCA Oih1t1
Ssa1t1      NNNNNNN----NNNNNNNN--NNNNNNNNNGGUUCCAU----GA-GCUAGUUAAGCGUGU--CGAAG--GGUUGU----CUUCGUCACCAACACA----CACAGUU------AUAAUAACUGGCAAAGAAAACAAU------------------------------------------------------AAUUUCGCAGUAGCUGCGUAA------------------UA-GCACUCUGC------------------------------AUCGCCUAACGGUAUC------------------UCCUAUGUACCGUUAACGCGAUUCAACCUAUA-----------------------------------------------------GUAGGAUAC---GCUAGGCACUGCC------------GUUUGAAGUCUGCCUAGAAGAGA-UUAA--UCAAAC-UA----GCAUAAUGA----CGGAU-GUCUAUCACCUCCCAUUA-UGC---GAAACCUAUU------GAUAGACUACGCA-CGUAG-----------------------AAGUGCUAGUA----UCAGAACCUCUGGAC-GCNNNNNNNNNNNNNNN-NNNNNNNNNNN Ssa1t1
Sxy1t1      NNNNNNN----NNNNNNNN--NNNNNNNNNGGUUCCAU----GA-GCUAGUUAAGCGUGU--CGGAG--GGUUGU----CUUCGUCACCAACACA----CACAGUU------AUAAUAACUGGCAAAGAAAACAAU------------------------------------------------------AAUUUCGCAGUAGCUGCGUAA------------------UA-GCACUCUGC------------------------------AUCGCCUAACGGUAUC------------------UCCUAUGUACCGUUAACGCGAUUCAACCUAUA-----------------------------------------------------GUAGGAUAC---GCUAGGCACUGCC------------GUUUGAAGUCUGCCUAGAAGAGA-UUAA--UCAAAC-UA----GCAUAAUGA----CGGAU-GUCUAUCACCUCCCAUUA-UGC---GAAACCUAUU------GAUAGACUACGCA-CGUAG-----------------------AAGUGCUAGUA----UCAGAACCUCUGGAC-GCNNNNNNNNNNNNNNN-NNNNNNNNNNN Sxy1t1
Sau314t101  GGGGACG----UUCAUGGA--UUCGACAGGGGUCCCCC----GA-GCUCAUUAAGCGUGU--CGGAG--GGUUGU----CUUCGUCAUCAACACA----CACAGUU-----UAUAAUAACUGGCAAAUCAAACAAU------------------------------------------------------AAUUUCGCAGUAGCUGCCUAA------------------UC-GCACUCUGC------------------------------AUCGCCUAACAGCAUU------------------UCCUAUGUGCUGUUAACGCGAUUCAACCUUA------------------------------------------------------AUAGGAUAU---GCUAAACACUGCC------------GUUUGAAGUCUGUUUAGAAGAAACUUAA--UCAAAC-UA----GCAUCAUGU----UGGUU-GUUUAUCACUUUUCAUGA-UGC---GAAACCUAUC------GAUAAACUACACA-CGUAG-----------------------AAAGAUGUGUA----UCAGGACCUUUGGAC-GCGGGUUCAAAUCCCGC-CGUCUCCAuau Sau314t101
Sau353t60   GGGGACG----UUUCUGGA--UUCGACAGGGGUCCCCC----GA-GCUCAUUAAGCGUGU--CGGAG--GGUUGU----CUUCGUCAUCAACACA----CACAGUU-----UAUAAUAACUGGCAAAUCAAACAAU------------------------------------------------------AAUUUCGCAGUAGCUGCCUAA------------------UC-GCACUCUGC------------------------------AUCGCCUAACAGCAUU------------------UCCUAUGUGCUGUUAACGCGAUUCAACCUUA------------------------------------------------------AUAGGAUAU---GCUAAACACUGCC------------GUUUGAAGUCUGUUUAGAAGAAACUUAA--UCAAGC-UA----GCAUCAUGU----UGGUU-GUUUAUCACUUUUCAUGA-UGC---GAAACUUUUC------GAUAAACUACACA-CGUAG-----------------------AAAGAUGUGUA----UCAGGACCUCUGGAC-GCGGGUUCAAAUCCCGC-CGUCUCCAuau Sau353t60
Sau355t8    GGGGACG----UUCAUGGA--UUCGACAGGGGUCCCCC----GA-GCUCAUUAAGCGUGU--CGGAG--GGUUGU----CUUCGUCAUCAACACA----CACAGUU-----UAUAAUAACUGGCAAAUCAAACAAU------------------------------------------------------AAUUUCGCAGUAGCUGCCUAA------------------UC-GCACUCUGC------------------------------AUCGCCUAACAGCAUU------------------UCCUAUAUGCUGUUAACGCGAUUCAACCUUA------------------------------------------------------AUAGGAUAU---GCUAAACACUGCC------------GUUUGAAGUCUGUUUAGAAGAAACUUAA--UCAAGC-UA----GCAUCAUGU----UGGUU-GUUUAUCACUUUUCAUGA-UGC---GAAACCUUUC------GAUAAACUACACA-CGUAG-----------------------AAAGAUGUGUA----UCAGGACCUCUGGAC-GCGGGUUCAAAUCCCGC-CGUCUCCAuau Sau355t8
Sau357t22   GGGGACG----UUCAUGGA--UUCGACAGGGGUCCCCC----GA-GCUCAUUAAGCGUGU--CGGAG--GGUUGG----CUUCGUCAUCAACACA----CACAGUU-----UAUAAUAACUGGCAAAUCAAACAAU------------------------------------------------------AAUUUCGCAGUAGCUGCCUAA------------------UC-GCACUCUGC------------------------------AUCGCCUAACAGCAUU------------------UCCUAUGUGCUGUUAACGCGAUUCAACCUUA------------------------------------------------------AUAGGAUAU---GCUAAACACUGCC------------GUUUGAAGUCUGUUUAGAAGAAACUUAA--UCAAGC-UA----GCAUCAUGU----UGGUU-GUUUAUCACUUUUCAUGA-UGC---GAAACCUUUC------GAUAAACUACACA-CGUAG-----------------------AAAGAUGUGUA----UCAGGACCUCUGGAC-GCGGGUUCAAAUCCCGC-CGUCUCCAuua Sau357t22
Sau359t4    GGGGACG----UUCAUGGA--UUCGACAGGGGUCCCCC----GA-GCUCAUUAAGCGUGU--CGGAG--GGUUGU----CUUCGUCAUCAACACA----CACAGUU-----UAUAAUAACUGGCAAAUCAAACAAU------------------------------------------------------AAUUUCGCAGUAGCUGCCUAA------------------UC-GCACUCUGC------------------------------AUCGCCUAACAGCAUU------------------UCCUAUAUGCUGUUAACGCGAUUCAACCUUA------------------------------------------------------AUAGGAUAU---GCUAAACACUGCC------------GUUUGAAGUCUGUUUAGAAGAAACUUAA--UCAAGC-UA----GCAUCAUGU----UGGUU-GUUUAUCACUUUUCAUGA-UGC---GAAACCUUUC------GAUAAACUACACA-CGUAG-----------------------AAAGAUGUGUA----UCAGGACCUCUGGAC-GCGGGUUCAAAUCCCGC-CGUCUCCAuua Sau359t4
Sau360t385  GGGGACG----UUCAUGGA--UUCGACAGGGGUCCCCC----GA-GCUCAUUAAGCGUGU--CGGAG--GGUUGG----CUUCGUCAUCAACACA----CACAGUU-----UAUAAUAACUGGCAAAUCAAACAAU------------------------------------------------------AAUUUCGCAGUAGCUGCCUAA------------------UC-GCACUCUGC------------------------------AUCGCCUAACAGCAUU------------------UCCUAUGUGCUGUUAACGCGAUUCAACCUUA------------------------------------------------------AUAGGAUAU---GCUAAACACUGCC------------GUUUGAAGUCUGUUUAGAAGAAACUUAA--UCAAGC-UA----GCAUCAUGU----UGGUU-GUUUAUCACUUUUCAUGA-UGC---GAAACCUUUC------GAUAAACUACACA-CGUAG-----------------------AAAGAUGUGUA----UCAGGACCUCUGGAC-GCGGGUUCAAAUCCCGC-CGUCUCCAuau Sau360t385
Sep1t64     GGGGACG----UUCUUGGA--UUCGACAGGGGUCCCC-----GA-GCUUAUUAAGCGUGU--CGGAG--GGUUGG----CUCCGUCAUCAACACA---UUUCGGUU-----AAAUAUAACUGACAAAUCAAACAAU------------------------------------------------------AAUUUCGCAGUAGCUGCGUAA------------------UA-GCCA-CUGC------------------------------AUCGCCUAACAGCAUC------------------UCCUACGUGCUGUUAACGCCAUUCAACCCAA------------------------------------------------------GUAGGAUAU---GCUAAACACUGCC------------GCUUGAAGUCUGUUUAGAUGAAAUAUAA--UCAAGC-UA----GUAUCAUGU----UGGUU-GUUUAUUGCUUAGCAUGA-UGC---GAAAAUUAUC------AAUAAACUACACA-CGUAG-----------------------AAAGAUUUGUA----UCAGGACCUCUGGAC-GCGGGUUCGAAUCCCGC-CGUCUCCAuua Sep1t64
Sep1t68     GGGGACG----UUCUUGGA--UUCGACAGGGGUCCCCC----GA-GCUUAUUAAGCGUGU--CGGAG--GGUUGG----CUCCGUCAUCAACACA---UUUCGGUU-----AAAUAUAACUGACAAAUCAAACAAU------------------------------------------------------AAUUUCGCAGUAGCUGCGUAA------------------UA-GCCA-CUGC------------------------------AUCGCCUAACAGCAUC------------------UCCUACGUGCUGUUAACGCGAUUCAACCCUA------------------------------------------------------GUAGGAUAU---GCUAAACACUGCC------------GCUUGAAGUCUGUUUAGAUGAAAUAUAA--UCAAGC-UA----GUAUCAUGU----UGGUU-GUUUAUUGCUUAGCAUGA-UGC---GAAAAUUAUC------AAUAAACUACACA-CGUAG-----------------------AAAGAUUUGUA----UCAGGACCUCUGGAC-GCGGGUUCGAAUCCCGC-CGUCUCCAuua Sep1t68
Sep1t66     GGGGACG----UUCUUGGA--UUCGACAGGGGUCCCC-----GA-GCUUAUUAAGCGUGU--CGGAG--GGUUGG----CUCCGUCAUCAACACA---UUUCGGUU-----AAAUAUAACUGACAAAUCAAACAAU------------------------------------------------------AAUUUCGCAGUAGCUGCGUAA------------------UA-GCCA-CUGC------------------------------AUCGCCUAACAGCAUC------------------UCCUACGUGCUGUUAACGCGAUUCAACCCUA------------------------------------------------------GUAGGAUAU---GCUAAACACUGCC------------GCUUGAAGUCUGUUUAGAUGAAAUAUAA--UCAAGC-UA----GUAUCAUGU----UGGUU-GUUUAUUGCUUAGCAUGA-UGC---GAAAAUUAUC------AAUAAACUACACA-CGUAG-----------------------AAAGAUUUGUA----UCAGGACCUCUGGAC-GCGGGUUCGAAUCCCGC-CGUCUCCAuua Sep1t66
Lmo1t47     GGGGAUG-----UUACGGA--UUCGACAGGGAUAGUUC----GA-GCUUGAGUUGCGAGU--CGGGG--GGAUCGU---CCUCGUUAUCA---------ACGUC-AAAGCCAAUAAUAACUGGCAAAGAAAAACAA------------------------------------------------------AACCUAGCUUUCGCUGCCUAA------------------UAAGCAGUAGCAUAGCU-------------------------GAUCCUCCGUGCAUC-------------------GCCCAUGUGCUACGGUAAGGGUCUCACUCUAA-----------------------------------------------------GUGGGCUAC---ACUAGUUAAUCUCC-----------GUCUGGGGUUAAA-UAGAAGAGCUUAA---UCAGAC-UA----GCUGAAUGGA---AGCCU-GUUACCGGGCCGAUGUUUAUGC---GAAAUGCUAAUA----CGGUGACUACGCU-CGUAG-----------------------AUAUUUAAGUG----CCGAUAUUUCUGGAC-GUGGGUUCGACUCCCAC-CAUCUCCAuau Lmo1t47
Lmo8t9      GGGGAUG-----UUACGGA--UUCGACAGGGAUAGUUC----GA-GCUUGAGUUGCGAGU--CGGGG--GGAUCGU---CCUCGUUAUCA---------ACGUC-AAAGCCAAUAAUAACUGGCAAAGAAAAACAA------------------------------------------------------AACCUAGCUUUCGCUGCCUAA------------------UAAGCAGUAGCAUAGCU-------------------------GAUCCUCCGUGCAUC-------------------GCCCAUGUGCUACGGUAAGGGUCUCACUCUAA-----------------------------------------------------GUGGGCUAC---ACUAGUUAAUCUCC-----------GUCUGGGGUUAAA-UAGAAGAGCUUAA---UCAGAC-UA----GCUGAAUGGA---AGCCU-GUUACUGGGCCGAUGUUUAUGC---GAAAUGCUAAUA----CGGUGACUACGCU-CGUAG-----------------------AUAUUUAAGUG----CCGAUAUUUCUGGAC-GUGGGUUCGACUCCCAC-CAUCUCCAuau Lmo8t9
Lmo1t47     NNNNNNN-----NNNNNNN--NNNNACAGGGAUAGUUC----GA-GCUUGAGUUGCGAGU--CGGGG--GGAUCGU---CCUCGUUAUCA---------ACGUC-AAAGCCAAUAAUAACUGGCAAAGAAAAACAA------------------------------------------------------AACCUAGCUUUCGCUGCCUAA------------------UAAGCAGUAGCAUAGCU-------------------------GAUCCUCCGUGCAUC-------------------GCCCAUGUGCUACGGUAAGGGUCUCACUCUAA-----------------------------------------------------GUGGGCUAC---ACUAGUUAAUCUCC-----------GUCUGGGGUUAAA-UAGAAGAGCUUAA---UCAGAC-UA----GCUGAAUGGA---AGCCU-GUUACCGGGCCGAUGUUUAUGC---GAAAUGCUAAUA----CGGUGACUACGCU-CGUAG-----------------------AUAUUUAAGUG----CCGAUAUUUCUGGNN-NNNNNNNNNNNNNNNNN-NNNNNNNNNNN Lmo1t47
Lin140t1    NNNNNNN-----NNNNNNN--NNNNNNNNNGAUAGUUC----GA-GCUUGAUUUGCGAGU--CGGGG--GGAUCGU---CCUCGUUAUCA---------ACGUC-AAAGCCAAUAAUAACUGGCAAAGAAAAACAA------------------------------------------------------AACCUAGCUUUCGCUGCCUAA------------------UAAGCAGUAGCAUAGCU-------------------------GAUCCUCCGUGCAUC-------------------GCCCAUGUGCUACGGUAAGGGUCUCACUCUAA-----------------------------------------------------GUGGGCUAC---ACUAGUUAAUCUCC-----------GUCUGAGGUUAAA-UAGAAGAGCUUAA---UCAGAC-UA----GCUGAAUGGA---AGCCU-GUUACCGGGCUGAUGUUUAUGC---GAAAUGCUAAUA----CGGUGACUACGCU-CGUAG-----------------------AUAUUCAAGUG----CCGAUAUUUCUGGAC-GUNNNNNNNNNNNNNNN-NNNNNNNNNNN Lin140t1
Lin142t8    GGGGAUG-----UUACGGA--UUCGACAGGGAUAGUUC----GA-GCUUGAGUUGCGAGU--CGGGG--GGAUCGU---CCUCGUUAUCA---------ACGUC-AAAGCCAAUAAUAACUGGCAAAGAAAAACAA------------------------------------------------------AACCUAGCUUUCGCUGCCUAA------------------UAAGCAGUAGCAUAGCU-------------------------GAUCCUCCGUGCAUC-------------------GCCCAUGUGCUACGGUAAGGGUCUCACUCUAA-----------------------------------------------------GUGGGCUAC---ACUAGUUAAUCUCC-----------GUCUGAGGUUAAA-UAGAAGAGCUUAA---UCAGAC-UA----GCUGAAUGGA---AGCCU-GUUACCGGGCUGAUGUUUAUGC---GAAAUGCUAAUA----CGGUGACUACGCU-CGUAG-----------------------AUAUUCAAGUG----CCGAUAUUUCUGGAC-GUGGGUUCGACUCCCAC-CAUCUCCAuau Lin142t8
Lmo8t9      GGGGAUG-----UUACGGA--UUCGACAGGGAUAGUUC----GA-GCUUGAGUUGCGAGU--CGGGG--GGAUCGU---CCUCGUUAUCA---------ACGUC-AAAGCCAAUAAUAACUGGCAAAGAAAAACAA------------------------------------------------------AACCUAGCUUUCGCUGCCUAA------------------UAAGCAGUAGCAUAGCU-------------------------GAUCCUCCGUGCAUC-------------------GCCCAUGUGCUACGGUAAGGGUCUCACUCUAA-----------------------------------------------------GUGGGCUAC---ACUAGUUAAUCUCC-----------GUCUGGGGUUAAA-UAGAAGAGCUUAA---UCAGAC-UA----GCUGAAUGGA---AGCCU-GUUACUGGGCCGAUGUUUAUGC---GAAAUGCUAAUA----CGGUGACUACGCU-CGUAG-----------------------AUAUUUAAGUG----CCGAUAUUUCUGGAC-GUGGGUUCGACUCCCAC-CAUCUCCAuau Lmo8t9
Lwe1t2      NNNNNNN-----NNNNNNN--NNNNACAGGGAUAGUUC----GA-GCUUGAGUUGCGAGU--CGGGG--GGAUCGU---CCUCGUUAUCA---------ACGUC-AAAGCCAAUAAUAACUGGCAAAGAAAAACAA------------------------------------------------------AACCUAGCUUUCGCUGCCUAA------------------UAAGCAGUAGCAUAGCU-------------------------GAUCCUCCGUGCAUC-------------------GCCCAUGUGCUACGGUAAGGGUCUCACUCUAA-----------------------------------------------------GUGGGCUAC---ACUGGCUAAUCUCC-----------GUCUGAGGUUAGU-UGGAAGAGCUUAA---UCAGAC-UA----GCUGAAUGGA---AGCCU-GUUACCGGGCCGAUGUUUAUGC---GAAAUGCUAAUA----CGGUGACUACGCU-CGUAG-----------------------AUAUUUAAGUG----CCGAUAUUUCUGGNN-NNNNNNNNNNNNNNNNN-NNNNNNNNNNN Lwe1t2
Lse1t1      NNNNNNN-----NNNNNNN--NNNNACAGGGAUAGUUC----GA-GCUUGAGUUGCGAGU--CGGGG--GGAUCGU---CCUCGUUAUCA---------ACGUC-AAAGCCAAUAAUAACUGGCAAAGAAAAACAA------------------------------------------------------AACCUAGCUUUCGCUGCCUAA------------------UAAGCAGUAGCAUAGCU-------------------------GAUCCUCCGUGCAUC-------------------GCCCAUGUGCUACGGAAAGGGUCUCACUUUAA-----------------------------------------------------GUGGGCUAC---ACUAAAUAAUCUCC-----------GUCUGGGGUUAGU-UAGAAGAGCUUAA---UCAGAC-UA----GCUGAAUGGA---AGCCU-GUUACCGGGCUGAUGUUUAUGC---GAAAUACUAAUA----CGGUGACUACGCU-CGUAG-----------------------AUAUUUAAGUG----CCCAUAUUUCUGGNN-NNNNNNNNNNNNNNNNN-NNNNNNNNNNN Lse1t1
Lgr4t2      NNNNNNN-----NNNNNNN--NNNNACAGGGAUAGUUC----GA-GCUUGAGUUGCGAGU--CGGGG--GGAUCGU---CCUCGUUAUCA---------ACGUC-AAAGCCAAUAAUAACUGGCAAAGAAAAACAA------------------------------------------------------AACCUAGCUUUCGCUGCCUAA------------------UAAGCAGUAGCAUAGCU-------------------------GAUCCUCCGUGCAUC-------------------GCCCAUGUGCUACGGUAAGGGUCUCACUCUAA-----------------------------------------------------GUGGGCUAC---ACUAGUUAAUCUCC-----------GUCUGAGGUUAAA-UAGAAGAGCUUAA---UGAGAC-UA----GCUGAAUGGA---AGCCU-GUUACCGGGCUGAUGUUUAUGC---GAAAUGCUAAUA----CGGUGACUACGCU-CGUAG-----------------------AUAUUCAAGUG----CCGAUAUUUCUGGNN-NNNNNNNNNNNNNNNNN-NNNNNNNNNNN Lgr4t2
Lgr4t1      NNNNNNN-----NNNNNNN--NNNNACAGGGAUAGGUC----GA-GCUUGAGUUGCGAGC--CGGGG--GGAUCGG----CCCGUCAUCA---------ACGUC-AAAGCCAAUAAUAACUGGCAAACAAAACAAC------------------------------------------------------AAUUUAGCUUUCGCUGCCUAA------------------UAGCAGUCUGAAUAGCU-------------------------GAUCCUCCGUGCAUC-------------------ACCCAUGUGCUACGGUAAGGGUCUCACUUUUAA----------------------------------------------------GUGGGUUAC---GCUGGCUUAUCUCC-----------GUCUGGGGCAAAC-GAGAAGAGCAUAA---UCAGAC-UA----GCUAGAUAGA---GCCCU-GACGCCGGGCAGACAUCUAUGC---GAAAUCCAAAUA----CGGCAACUACGCU-CGUAG-----------------------AUGCUCAAGUG----CCGAUAUUUCUGGNN-NNNNNNNNNNNNNNNNN-NNNNNNNNNNN Lgr4t1
Liv1t2      NNNNNNN-----NNNNNNN--NNNNACAGGGAUAGUUC----GA-GCUUGAGUUGCGAGU--CGGGG--GGAUCGU---CCUCGUUAUUA---------ACGUC-AAAGCCAAUAAUAACUGGCAAAGAAAAACAA------------------------------------------------------AACCUAGCUUUCGCUGCCUAA------------------UAAGCAGUAGCAUAGCU-------------------------GAUCCUCCGUGCAUC-------------------GCCCAUGUGCUACGGUAAGGGUCUCACUUUAA-----------------------------------------------------GUGGGCUAC---ACUAAAUAAUCUCC-----------GUCUGGGGUUAGU-UAGAAGAGCUUAA---UCAGAC-UA----GCUGAAUGGA---AGCCU-GUUACCGGGCUGAUGUUUAUGC---GAAAUGCUAAUA----CGGUGACUACGCU-CGUAG-----------------------AUAUUUAAGUG----CCGAUAUUUCUGGNN-NNNNNNNNNNNNNNNNN-NNNNNNNNNNN Liv1t2
FIRMICUTES: Lactobacillales
Lga4t7      GGGGAUG----UUUUGGGA--UUCGACAGGCGUAGAUU----CG-CGUUGA-CUGCGAUU--CGUAG--GUCACGU---CUACGUUAAA----------ACGUCACAGUUAAAUUAUAACUGCAAAUAACGAAAAU------------------------------------------------------UCUUACGCAGUAGCUGCUUAG-----------------------UCAGGCUGCGU--------------------------GAUCCAAUGACGGAUU------------------GCUCGUGUCUGUCUGCGGGUCUUACCAUUUA------------------------------------------------------ACGAGCUAC---GUUUAACUACUU-------------ACCUUA--AUAGUUAGAAAUAAGAUUCU---UAGGU-UA----GUUUUGAUAGUUUAGCCCUGUUAUAUGGCGUUUUAUCAAAGC--GAAGUUUAAGUA----AUAUAACUAUGAU-CGUAG-----------------------AGGUUAACGAC----GGAAUACGUUUGGAC-AGGGGUUCAAUUCCCCU-CAUCUCCAuaa Lga4t7
Ljo4t4      GGGGAUG----UUUUGGGA--UUCGACAGGCGUAGAUU----CG-CGUUGA-CUGCGAUU--CGUAG--GUCACGU---CUACGUUAAAA---------ACGUCACAGUUAAAUUAUAACUGCAAAUAACGAAAAU------------------------------------------------------UCUUACGCAGUAGCUGCUUAG-----------------------UCAGCCUGCGU--------------------------GAUCCAAAGAUGGAUU------------------GCUCGUGUCUAUCUACGGGUCUUACCAUUUA------------------------------------------------------ACGAGCUAC---GUUUAACUACUU-------------ACCUUA--AUAGUUAGAAAUAAGAUUCU---UAGGU-UA----GUUUUGAUAGUUUAGCCCUGUUAUAUGGCGUUUUAUCAAAGC--GAAUUUUAAGUA----AUAUAACUAUGAU-CGUAG-----------------------AUGUUAACGAC----GAAAUACGUUUGGAC-AGGGGUUCAAUUCCCCU-CAUCUCCAuag Ljo4t4
Lsa1t3      GGGGCCG-----UUACGGA--UUCGACAUGUGUAGGUG----AG-CGUGAA-UUGCACUU--CGUAG--GUUACGU---CUGCGUUAACA---------ACGUU-ACAGUUAAUUAUAACUGCAAACAAUAACAAU------------------------------------------------------UCUUACGCUGUAGCUGCCUAA------------------ACACCAGCAUAGCGU---------------------------GAUCCGUCUGACUUC-------------------ACCCAAGGGUUAGAUCCGGGUCUCAAAUUAA------------------------------------------------------UUGGGUUAC---GUUAAAUGCCGCC------------GUUUGA--AGUGUUUAAAAGAGAUUU----UCAAGC-UA---GUUAGUCCAUCCGAGCCUCUGUUGAACGGCGUUUUGGGCUAGC--GAAUUUCUAAAUA---GUUCGACUAUGAG-UGUAG-----------------------AGAUUGACGUG----GCAAUGCGCAUGGAC-GCGGGUUCAACCCCCGC-CGGCUCCAuug Lsa1t3
Edu1t2      NNNNNNN----NNNNNNNN--NNNNNNAAGCACAGUUCG---AG-CUUGAA-UUGCGUUU--CGUAG--GUUACGU---CUACGUUAAA----------ACGUU-ACAGUUAAAUAUAACUGCUAAAAACGAAAAC---------------------------------------------------AACUCUUACGCUUUAGCUGCCUAA------------------AAACAGUUAGCGUA----------------------------GAUCCUCUCGGCAUCG------------------CCCAUGUGCUCGAGUAAGGGUCUCAAAUUUA------------------------------------------------------GUGGGAUAC---GUUAAACUUUUCC------------GUCUGU--AAAGUUUAAAAGAGAUCAU----CAGAC-UA----GCGAUACAGAA--UGCC-UGUCACUCGGCAAG-CUGUAAAGC--GAAACCUCAAAU---GAGUUGACUAUGAA-CGUAG-----------------------AUUUUUAAGUG----UCGAUGUGUUUNNNN-NNNNNNNNNNNNNNNNN-NNNNNNNNNNN Edu1t2
Lde3t3      GGGGAUG----UUUUGGGA--UUCGACAGGCGCAGACC----CG-CGCUGG-UUGCGAUU--CGUAG--GUUACGU---CUACGUUAAA---------ACGUUAAACAGUUUAAAUUAACUGCAAACGAAAACUCA---------------------------------------------------------UACGCUGUAGCUGCUUAG------------------UUCAGCCCAGC-------------------------------UGCCAAUAGACUGCCU------------------GCCCGUGGCGGUCUUGCGGUAUCAACAUU--------------------------------------------------------ACGGGAUAC---GCUUGCCUAUCAC------------ACCUGA--AUAAGCGAGAAGAGACUAA----CAGGU-UA----GCCGUGGCUGUUUGGCCCUGUCAUAUGGCGUUUUGCCCCGGU--GAAGUUUAAAUA----AUAUGACUAUGAU-CGUAG-----------------------AGAUUAGUGAC----GGGAUGCGUUUGGAC-AGGGGUUCAAUUCCCCU-CAUCUCCAucu Lde3t3
Lca4t1      GGGGGUG-----UAAUGGU--CUCGACAUUGCUUUUCG----CA-CAUGCA-GUGCACCU--CGGAG--GC-UCGG---CUCCGUCAUC----------AACGG-AACAGUUAAUAUAACUGCAAAGAACGAAAAU------------------------------------------------------UCUUACGCUUUAGCUGCUUAA------------------UAACCAGCUAGCGU----------------------------GAUCCUUCCGACUUC-------------------GCUCAAGGGUCGGGUCUGGGUCUCAAAUUA-------------------------------------------------------UUGAGCUAC---GGUUAAUGUUGCC------------ACCUGA--GGCAUUAACAAGAGACUAG----UAGGU-UA----GCUGCGUUGUGUUAGCCUUGCUGGCUGGCGCGACAUCGCGGC--GAAUUUUAAAUA----AGUCAGCUAUAGG-UGUAG-----------------------AGCUGCAUGUA----GCAGGGGUGAUGGAC-AGGAGUUCGAUUCUCCU-CACCUCCAuua Lca4t1
Lac9t9      GGGGAUG----UUUUGGGA--UUCGACAGGCGUAGACC----CG-CAUUGA-CUGCGAUU--CGUAG--GUUACGU---CUACGUAAAA----------ACGUU-ACAGUUAAAUAUAACUGCAAAUAACAAAAAU------------------------------------------------------UCUUACGCAUUAGCUGCUUAA------------------UUUAGCGCAUGCGU----------------------------UGCUCUUGACCAGUUU------------------ACUCGUGACUGGUUUUCGAGUAUCAACUUUA------------------------------------------------------GCGAGUUAC---GUUUAACUACCUC------------ACCUGA--AUAGUUAAAAAGAGUCUUAA---CAGGU-UA----GCUGGUUCAUACUAGCCCUGUUAUAUGGCGUUUUGAACUAGU--GAAGUUUAAGUA----AUAUAACUAUGAU-CGUAG-----------------------AGGUUAAUGAC----GAGAUGCGUUUGGAC-AGGGGUUCAAUUCCCCU-CAUCUCCAuag Lac9t9
Lhe1t6      NNNNNNN----NNNNNNNN--NNNNNNNNNCGUAGAUU----CG-CAUUGA-CUGCGAUU--CGUAG--GUUACGU---CUACGUAAAA----------ACGUU-ACAGUUAAAUAUAACUGCAAAUAACAAAAAU------------------------------------------------------UCUUACGCAUUAGCUGCUUAA------------------UUUAGCGCAUGCGU----------------------------UGCUCUUUGUCGGUUU------------------ACUCGUGGCUGACACUGAGUAUCAACUUUA-------------------------------------------------------GCGAGUUAC---GUUUAACUAUCUC------------ACCUGA--AUAGUUGAAAAGAGUCUUAA---CAGGU-UA----GCUAGCUCAUCCUAGCCCUGUUAUAUGGCGUUUUGAGCUAGU--GAAGUUCAAGUA----AUAUAACUAUGAU-CGUAG-----------------------AGGUCAGUGAC----GGAAUGCGUCUGGAC-AGNNNNNNNNNNNNNNN-NNNNNNNNNNN Lhe1t6
Lga1t1      NNNNNNN----NNNNNNNN--NNNNNNNNNCGUAGAUU----CG-CAUUGA-NUGCGAUU--CGUAG--GUUACGU---CUACGUAAAA----------ACGUU-ACAGUUAAAUAUAACUGCAAAUAACAAAAAU------------------------------------------------------UCUUACGCAUUAGCUGCUUAA------------------UUUAGCGCAUGCGU----------------------------UGCUCUUUGUCGGUUU------------------ACUCGUGGCUGACACUGAGUAUCAACUUUA-------------------------------------------------------ACGAGUUAC---GUUUAACUACCUC------------ACCUGA--AUAGUUGAAAAGAGUCUUAA---CAGGU-UA----GCUAGCUCAUCCUAGCCCUGUUAUAUGGCGUUUUGGGCUAGU--GAAGUUCAAGUA----AUAUAACUAUGAU-CGUAG-----------------------AGUUCAGUGAC----GGAAUGCGUUUGGAC-ACNNNNNNNNNNNNNNN-NNNNNNNNNNN Lga1t1
Lpl1t1      NNNNNNN----NNNNNNNN--NNNNNNNNNUAUAGUUU----GA-GUUCGA-UUGCGCUU--CGUAU--GUUGCGU---CUACGUAAAA----------ACGCUCAGUUUAAAUUAUAACUGCAAAAAAUAAUAAC---------------------------------------------------AAUUCUUACGCUUUAGCUGCCUAA------------------UAAGCGCUUA-ACGUA--------------------------GAUCCUCCCAGGAUC-------------------GUCCAUGUUCUGGAUCUGGGUCCUAAAUUUA------------------------------------------------------GUGGACUUAC--GCUCAAAGCUUCC------------ACCUG--GAGUUGCGAGAAGAGACUAAU---CAGGU-UA----GUCAUUGCUGGG-UGCCCUGUCAUACGGCGUUU-GCAAUGAU--GAAAUUUAAAUA----GUAUGAAUAUGAG-CGUAG-----------------------AUAUCCGAGGG----GCAAUAUGCUUAGAC-GCNNNNNNNNNNNNNNN-NNNNNNNNNNN Lpl1t1
Lpl6t1      GGGGAUG-----UUCUGGA--UUCGACAGGUAUAGUUU----GA-GUUCGGAUUGCGCUU--CGUAG--GUUGUGU---CUACGUAAAA----------ACGCUCAGUUUAAAUUAUAACUGCAAAAAAUAAUAAC---------------------------------------------------AAUUCUUACGCUUUAGCUGCCUAA------------------UAAGCGCUUA-ACGUA--------------------------GAUCCUCCCAGGAUC-------------------GUCCAUGUUCUGGAUCUGGGUCCUAAAUUUA------------------------------------------------------GUGGACUUAC--GCUCAAAGCUUCC------------ACCUG--GAGUUGCGAGAAGAGACUAAU---CAGGU-UA----GUCAUUGCUGGG-UGCCCUGUCAUACGGCGUUU-GCAAUGAU--GAAAUUUAAAUA----GUAUGAAUAUGAG-CGUAG-----------------------AUAUCCGAGGG----GCAAUAUGCUUGGAC-GCGAGUUCGACUCUCGC-CAUCUCCAuua Lpl6t1
Lbr1t2      GGGGCCG-----UUCUGGA--UUCGACUGGUAUAGGUUG---CG-CCCCAA-CUGCACUC--CGUAG---CGGCAU---CUACGUUAAA----------AGGUC-CAGUUUAAUUAUAACUGCAAAAAAUAAUAAC---------------------------------------------------AAUUCUUACGCUUUAGCUGCUUAA------------------UAGGCGCUUAACGUA---------------------------GAUCCUCCUAGGCUU------------------GUCCGUGGUCUAGAUCUGGGUCCUAAAUUUA-------------------------------------------------------ACGGACUUAC--GCUAACGACUCCC------------ACCUGA-AGUACGUUAGAAGAGAAAAA---UCAGGU-UA----GCUGUUCAUGUG-GGCCCUGACAGGCGGCAAGU-UGGGCAGU--GAAACCUUAAGUA---GUCUGAAUAUGAG-UGUAG-----------------------ACGUUGGGGUG----GCAAUAUGCUAGGAC-GCGGGUUCGAUCCCCGC-CGGCUCCAuau Lbr1t2
Ppe1t1      GGGGUCG-----UUAUGGA--UUCGACAGGUAUGGGUCG---AG-CCAUGA-CUGCAUUU--CGUAG--GUUACGG---CUACGUAAAA----------ACGUU--CAGUUUAUUAUAACUGCAAAAAAUAAUAAC---------------------------------------------------AAUUCUUACGCUUUAGCUGCCUAA-------------------UAGUAGCUUGACGUA--------------------------GAUCCGCCUAGUCUC-------------------GUCCAUGGGCUAGAUACGGGUCCUAAAUGAA------------------------------------------------------GUGGACUUGC--GCUUAAGUACUG-------------GCCUG--GGUGCUUAAGAAGAGGAUUUA---CAGAC-UA----GCGUUUUAAUGA-AGCCCCGACAUACGGCGUCU-UAUUUCGC--GAAAUUUAAGUA----GUAUGAAUAUGAA-UGUAG-----------------------AUGUCAUGGUG----GCGACAUGCUUGGAC-GCGGGUUCGACUCCCGC-CGACUCCAuuu Ppe1t1
Lme1t8      GGGUCUG----UUUUUGGAA-UUCGACAGGUCGUUUA-----GA-GCAUUGAUUGCGUUU--CGCC---AUCCG------GGCGCAAAA------------CGGG-CAG-AAAUUUUAACUGCAAAAAACGAAAAC------------------------------------------------------UCUUUCGCUAUCGCUGCCUAA------------------AAACCAGUGAUGCGUA--------------------------GCUUAAUCUUGGUU--------------------GCUGGCGUCUGAGGUUAGGCCAUAAAAG---------------------------------------------------------GCCAGAU-C---GUACUGCUUCUUAC-----------AUCUGGAAAAGCAGUAUUAAAUCAA-----UCAGGU-UA----GUUAUAUUGAAG-AGCCUUGAGCUAUGGCAGAC-AAUAUAAU--GAACUACAAAUA----AUAGCCCUAUAAA-CGUAG-----------------------AUAUUGGUGUA----UCGGGCGAUUUGGAC-AGGGGUUCGACUCCCCU-CAGAUCCAuuu Lme1t8
Lla16t2     NNNNNNN----NNNNNNNN--NNNNNNNNNCUGUUUA-----GG-GCAUGGACUGCGUUU--CGCC---AUCCG------GGCGUUAAAA-----------CGGG-CAG-AAAUUUUAACUGCAAAAAACGAAAAC------------------------------------------------------UCUUUCGCAAUCGCUGCCUAA------------------AAAACAGUGAUGCGUC--------------------------ACUUAAUCUUGGUA--------------------GCUGGCGUCUAAGGUUAGGUCAUAAAAA---------------------------------------------------------GUCAGAU-C---GCGUCGUUGCUUAG-----------AUUCGGAACAGCGGCGUUAAAUGAA-----UCGAGU-UA----GUGAUUGAUGUU-AGCCUCGUGUUGUGGCGGAA-UCAAUCAU--GAAACUUAAAUG----ACAACACUAUAAG-CGUAG-----------------------AGGUUCAUGUA----CCGGGCAGUUUGGAC-ANNNNNNNNNNNNNNNN-NNNNNNNNNNN Lla16t2
Lps1t1      NNNNNNN----NNNNNNNN--NNNNNNNNNUCGUUUA-----GA-GCAUUGCCUGCGUUU--CGCC---GUCCG------GGCGUUAAA------------CGGG-CAG-ACAUUUUAACUGCAAAAAACGAAAAC------------------------------------------------------UCUUACGCAAUCGCUGCUUAA------------------AAACCAGCAAUACGUA--------------------------GCUUAAUCUUGGUU--------------------UCUGACGUCUGAGAUUAGGCCAUAAAAG---------------------------------------------------------GUCAGAU-C---GCAUUGUUGUUUAC-----------AUCUGGAAUGGCAAUGUUAAAUUUA-----UCAGAU-UA----GUUAAUUUGAUU-AGCCGUGUGUUAUGGCGUAC-AAAUUGAU--GAAAUUCAAAUG----AUAGCACUAUAAG-CGUAG-----------------------GCGCCAAUGUA----UCGGACGGUUUGGAC-AGNNNNNNNNNNNNNNN-NNNNNNNNNNN Lps1t1
Ooe14t15    GGGGUAG-----UUCCGGAA-UUCGACAGGUUAUUA------CAAGCAUGGAUUGCGUUC--CC----GUUUGUCG------GGUUAAA------------GAC----UGCAGAUAUAACUGCAAAAAAUAAUGAA---------------------------------------------------CCAUCUUACGCAUUAGCUGCCUAA------------------UCGCAGUAGCGUA-----------------------------GCCCUUUGUUGA----------------------GUCCACGGCAACAUUCUCGGCCUAAUUA---------------------------------------------------------GUGGAUUA----GCUGCUGGCAUUUAU---------GUUCGGAAUAAAAGCAGUGAAACAAGAA----UCGAACUA----GCUC-UCGAUU--UGGAA--GUUAGCAACCUAAUCUUGAGC----GAAAUUAC------UUGUUAACUAUGAG-CGUAG-----------------------AUAUUUAUGUG---AUUGGAUAAUUUGGAC-AUGGGUUCGACUCCCAU-CUACUCCAuau Ooe14t15
Cma2t1      uagcaca-----auauguu--acauuauuuaugugag-----ca-aguucgauaaaaguu--cgucu-cccuaaa----gugauauaaa-----------acacuugaagcuaucuaaauauucauaaguuuaaaa---------------------------------------------------agcuauuauaacuuuuucuucuga------------------aaaauaaucaaagga---------------------------aauuuuuaCGGCAUC-------------------GCCCAUGUGCUCGGGUAAGGGUCCUAUAAUAA-----------------------------------------------------GUGGGAUAC---GCUAAAUUUUUCC------------GUCUGU--AAAGUUUAGAAGAGAUUAU----CAGAC-UA----GCGAUGCAUGA--UGCCU-GUUAGGCGGC-UAAUGUUCAGC---GAAACCUUAAUA----GCAUGACUAUGAA-CGUAG-----------------------AUGUCUAAGUG----CCGAUAUGCUUGGAC-AGGGGUUCGACUCCCCU-CGUCUCCAuau Cma2t1
Edu1t5      NNNNNNN-----NNNNNNN--NNNNNNNNNCACAGUUC----GA-GCUUGAAUUGCGUUU--CGUAG-GUUACGU----CUACGUUAAA-----------ACGUUACAGUUAAAUAUAACUGCUAAAAACGAAAAC---------------------------------------------------AACUCUUACGCUUUAGCUGCCUAA------------------AAA-CAGUUAGCGUA---------------------------GAUCCUCUCGGCAUC-------------------GCCCAUGUGCUCGAGUAAGGGUCUCAAAUUUA-----------------------------------------------------GUGGGAUAC---GUUAAACUUUUCC------------GUCUGU--AAAGUUUAAAAGAGAUCAU----CAGAC-UA----GCAAUACAGAA--UGCCU-GUCACUCGGCAAGCUGUAAAGC---GAAACCUCAAAU---GAGUUGACUAUGAA-CGUAG-----------------------AUUUUUAAGUG----UCGAUGUGUUUGGAC-GCNNNNNNNNNNNNNNN-NNNNNNNNNNN Edu1t5
Efa213t209  GGGGACG-----UUACGGA--UUCGACAGGCACAGUC-----GA-GCUUGAAUUGCGUUU--CGUAG-GUUACGU----CUACGUAAAA-----------ACGUUACAGUUAAAUAUAACUGCUAAAAACGAAAAC---------------------------------------------------AACUCUUACGCUUUAGCUGCCUAA------------------AAA-CAGUUAGCGUA---------------------------GAUCCUCUCGGCAUC-------------------GCCCAUGUGCUCGAGUAAGGGUCCUAACUUUA-----------------------------------------------------GUGGGAUAC---GUUUCAACUUUCC------------GUCUGU--AAGUUGAAAAAGAGAACAU----CAGAC-UA----GCGAUACAGAA--UGCCU-GUCACUCGGCAAGCUGUAAAGU---GAAUCCUUAAAU---GAGUUGACUAUGAA-CGUAG-----------------------AUUUUUAAGUG----GCGAUGUGUUUGGAC-GCGGGUUCGACUCCCGC-CGUCUCCAuug Efa213t209
Efa210t192  GGGGGCG-----UUACGGA--UUCGACAGGCAUAGUU-----GA-GCUUGAAUUGCGUUU--CGUAG-GUUACGG----CUACGUUAAA-----------ACGUUACAGUUAAAUAUAACUGCUAAAAACGAAAAC---------------------------------------------------AAUUCUUUCGCUUUAGCUGCCUAA------------------AAACCAGCUAGCGAA---------------------------GAUCCUCCCGGCAUC-------------------GCCCAUGUGCUCGGGUCAGGGUCCUAAUCGAA-----------------------------------------------------GUGGGAUAC---GCUAAAUUUUUCC------------GUCUGU--AAAAUUUAGAGGAGCUUAC----CAGAC-UA----GCAAUACAGAA--UGCCU-GUCACUCGGCACGCUGUAAAGC---GAACCUUUAAAU----GAGUGUCUAUGAA-CGUAG-----------------------AGAUUUAAGUG----GCAAUAUGUUUGGAC-GCGGGUUCGACUCCCGC-CGUCUCCAuuu Efa210t192
Efa5t89     NNNNNNN-----NNNNNNN--NNNNNNNNNCAUAGUU-----GA-GCUUGAAUUGCGUUU--CGUAG-GUUACGG----CUACGUUAAA-----------ACGUUACAGUUAAAUAUAACUGCUAAAAACGAAAAC---------------------------------------------------AAUUCUUUCGCUUUAGCUGCCUAA------------------AAACCAGCUAGCGAA---------------------------GAUCCUCCCGGCAUC-------------------GCCCAUGUGCUCGGGUCAGGGUCCUAAUCGAA-----------------------------------------------------GUGGGAUAC---GCUAAAUUUUUCC------------GUCUGU--AAAAUUUAGAAGAGCUUAC----CAGAC-UA----GCAAUACAGAA--UGCCU-GUCACUCGGCACGCUGUAAAGC---GAACCUUUAAAU----GAGUGUCUAUGAA-CGUAG-----------------------AGAUUUAAGUG----GCAAUAUGUUUGGAC-GCNNNNNNNNNNNNNNN-NNNNNNNNNNN Efa5t89
Seq1t1      GGGGUUG-----UUACGGA--UUCGACAGGCAUUAU------GAGGCCUAUUUUGCAACU--CAUC----GGCA------GAUGUAAAAA-----------UGCC--AGUUAAAUAUAACUGCAAAAAAUAACACA------------------------------------------------------ACUUACGCUUUAGCUGCCUAA------------------AAACCAGCCGGCGU----------------------------GACUUCUAUAGGAUU-------------------GCUUGUGUCUUAUUAGAGGUCUCAAAACA--------------------------------------------------------GCAAGCUAC---GUUUAGGUGAUU-------------GUCUAG--UCACCUAAAA-AGAGAACC---CUAGAC-UC----GCAG-GCUGAU--GGCUUGAGUUAUGUGUCCUUGGUCUGU----UAAAGUAAG------ACAUAACCUAUGGU-UGUAG-----------------------ACAAAUAGGUU----AGCAGGUGUUUGGAC-GUGGGUUCGACUCCCAC-CAGCUCCAuca Seq1t1
Seq2t1      GGGGUUG-----UUACGGA--UUCGACAGGCAUUAU------GAGGCCUAUUUUGCAACU--CAUC----GGCA------GAUGUAAAAA-----------UGCC--AGUUAAAUAUAACUGCAAAAAAUAACACA------------------------------------------------------ACUUACGCUUUAGCUGCCUAA------------------AAACCAGCCGGCGU----------------------------GACUUCUAUAGGAUU-------------------GUUUGUGUCUUAUUAGAGGUCUCAAAACA--------------------------------------------------------GCAAGCUAC---GUUUAGGUGAUU-------------GUCUAG--UCACCUAAAA-AGAGAACC---CUAGAC-UC----GCAG-GCUGAU--GGCUUGAGUUAUGUGUCCUUGGUCUGU----UAAAGUAAG------ACAUAACCUAUGGU-UGUAG-----------------------ACAAAUAGGUU----AGCAGGUGUUUGGAC-GUGGGUUCGACUCCCAC-CAGCUCCAuca Seq2t1
Ssu31t19    GGGGUUG-----UUACGGA--UUCGACAGGCAUUAU------GAGGCUUGUUCUGCAACU--CAUC----GGCA------GAUGUAAAAA-----------UGCC--AGUUAAAUAUAACUGCAAAAAAUACAAAC------------------------------------------------------ACUUACGCAUUAGCAGCUUAA------------------UAACCUGCCUGCGU----------------------------GACCAGUCGCGAAUU-------------------GCUUGUGUUUGCUGAUUGGUCUUAAAAUA--------------------------------------------------------GCAAGCUAC---GUUGGGAUUGA--------------GUCAGG--CAGUUCCAAA-AGAGAUUU---ACUGAC-UC----GCUU-GGUCUA--GGUUUGAGUUAUGUAUCGAGUUCAAGU----UAAAGUUAAAGCAAGACAUAACCUAUGGU-UGUAG-----------------------ACGAAUAAGUU----AGCAGGUGUUUGGAC-GUGGGUUCGACUCCCAC-CAGCUCCAuau Ssu31t19
Ssu6t39     GGGGUUG-----UUACGGA--UUCGACAGGCAUUAU------GAGGCUUGUUCUGCAACU--CAUC----GGCA------GAUGUAAAAA-----------UGCC--AGUUAAAUAUAACUGCAAAAAAUACAAAC------------------------------------------------------ACUUACGCAUUAGCAGCUUAA------------------UAACCUGCCUGCGU----------------------------GACCAGUCGCGAAUU-------------------GCUUGUGUUUGCUGAUUGGUCUUAAAAUA--------------------------------------------------------GCAAGCUAC---GUUGGGAUUGA--------------GUCAGG--CAGUUCCAAA-AGAGAUUU---ACUGAC-UC----GCUU-GGUCUA--GGUUUGAGUUAUGUAUCGAGUUCAAGU----UAAAGCAAG------ACAUAACCUAUGGU-UGUAG-----------------------ACGAAUAAGUU----AGCAGGUGUUUGGAC-GUGGGUUCGACUCCCAC-CAGCUCCAuau Ssu6t39
Sub1t1      GGGGUUG-----UUACGGA--UUCGACAGGCACUAU------GAGGCAUGUUUUGCAACU--CAUC----GGCA------GAUGUAAAAA-----------UGCC--AGUUAAAUAUAACUGCAAAAAAUACAAAC------------------------------------------------------UCUUACGCUUUAGCUGCCUAA------------------AAACCAGCUAGCGU----------------------------GACUUCUUCAAGAUU-------------------GCUUGUGUCCUGAUAGAAGUCUCAAAAACA-------------------------------------------------------GCAAGCUAC---GACUAAAGCCUU-------------GUCUAG--AGCCUUAGUA-AGAGAUUU---AUAGAC-UC----GCUA-AGUAAU--GGCUUGAGUUAUGUGUCCUUACUUAGU----CAAAACAAG------ACAUAACCUAUGGU-UGUAG-----------------------ACAAAUAUGUU----GGCAGGUGUUUGGAC-GUGGGUUCGACUCCCAC-CAGCUCCAuua Sub1t1
Spy12t13    GGGGUUG-----UUACGGA--UUCGACAGGCAUUAU------GAGGCAUGUUUUGCGUCC--CAUC----GGCA------GAUGUAAAU------------UGCC--AGUUAAAUAUAACUGCAAAAAAUACAAAC------------------------------------------------------UCUUACGCUUUAGCUGCCUAA------------------AAACCAGCUAGCGU----------------------------GACUUCUACAAGAUU-------------------GCUUGUGUCCUGUUAGAAGUCUCAAAAUA--------------------------------------------------------GCAAGCUAC---GGUUACGAAAUU-------------GUCUAG--UUUCGUGACA-AGAGAUUG---AUAGAC-UC----GCAA-ACUAAU--GGCUUGAGUUAUGUGUCUUUAGUUUGU----UAAAUGAAG------ACAUAACCUAUGGA-CGUAG-----------------------ACAAAUAUGUU----GGCAGGUGUUUGGAC-GUGGGUUCGACUCCCAC-CAGCUCCAuca Spy12t13
Spy19t8     GGGGUUG-----UUACGGA--UUCGACAGGCAUUAU------GAGGCAUGUUUUGCGUCC--CAUC----GGCA------GAUGUAAAU------------UGCC--AGUUAAAUAUAACUGCAAAAAAUACAAAC------------------------------------------------------UCUUACGCUUUAGCUGCCUAA------------------AAACCAGCUAGCGU----------------------------GACUUCUACAAGAUU-------------------GCUUGUGUCCUGUUAGAAGUCUCAAAAUA--------------------------------------------------------GCAAGCUAC---GGUUACGAAAUU-------------GUCUAG--UUUCGUGACA-AGAGAUUG---AUAGAC-UC----GCAA-ACUAAU--GGCUUGAGUUAUGUGUCUUUAGUUUGU----UAAAUGAAG------ACAUAACCUAUGGA-CGUAG-----------------------ACAAAUAUGUU----GGCAGGUGUUUGGAC-GUGGGUUCGACUCCCAC-CGGCUCCAuca Spy19t8
Sag5t145    GGGGUCG-----UUACGGA--UUCGACAGGCAUUAU------GAGGUAUAUUUCGCGACU--CAUC----GGCA------GAUGUAAAA------------UGCC--AGUUAAAUAUAACUGCAAAAAAUACAAAU------------------------------------------------------UCUUACGCAUUAGCUGCCUAA------------------AAAACAGCCUGCGU----------------------------GAUCUUCACAAGAUU-------------------GUUUGCGUUUUGCUAGAAGGUCUUAUUUAUCA-----------------------------------------------------GCAAACUAC---GUUUGGCUACU--------------GUCUAG--UUAGUUAAAA-AGAGAUUU---AUAGAC-UC----GCUA-UGUGAG--GGCUUGAGUUAUGUGUCAUCACCUAGU----UAAAUCAAU------ACAUAACCUAUAGU-UGUAG-----------------------ACAAAUAUAUU----AGCAGAUGUUUGGAC-GUGGGUUCGACUCCCAC-CGGCUCCAuau Sag5t145
Sag5t145    GGGGUCG-----UUACGGA--UUCGACAGGCAUUAU------GAGGUAUAUUUCGCGACU--CAUC----GGCA------GAUGUAAAA------------UGCC--AGUUAAAUAUAACUGCAAAAAAUACAAAU------------------------------------------------------UCUUACGCAUUAGCUGCCUAA------------------AAAACAGCCUGCGU----------------------------GAUCUUCACAAGAUU-------------------GUUUGCGUUUUGCUAGAAGGUCUUAUUUAUCA-----------------------------------------------------GCAAACUAC---GUUUGGCUACU--------------GUCUAG--UUAGUUAAAA-AGAGAUUU---AUAGAC-UC----GCUA-UGUGAG--GGCUUGAGUUAUGUGUCAUCACCUAGU----UAAAUCAAU------ACAUAACCUAUAGU-UGUAG-----------------------ACAAAUAUAUU----AGCAGAUGUUUGGAC-GUGGGUUCGACUCCCAC-CGGCUCCAuau Sag5t145
Sag227t117  GGGGUCG-----UUACGGA--UUCGACAGGCAUUAU------GAGGUAUAUUUUGCGACU--CAUC----GGCA------GAUGUAAAA------------UGCC--AGUUAAAUAUAACUGCAAAAAAUACAAAU------------------------------------------------------UCUUACGCAUUAGCUGCCUAA------------------AAAACAGCCUGCGU----------------------------GAUCUUCACAAGAUU-------------------GUUUGCGUUUUGCUAGAAGGUCUUAUUUAUCA-----------------------------------------------------GCAAACUAC---GUUUGGCUACU--------------GUCUAG--UUAGUUAAAA-AGAGAUUU---AUAGAC-UC----GCUA-UGUGAG--GGCUUGAGUUAUGUGUCAUCACCUAGU----UAAAUCAAU------ACAUAACCUAUAGU-UGUAG-----------------------ACAAAUAUAUU----AGCAGAUGUUUGGAC-GUGGGUUCGACUCCCAC-CGGCUCCAuau Sag227t117
Smu102t67   GGGGUCG-----UUACGGA--UUCGACAGGCAUUAU------GAGACCUAUUUUGCGACU--CAUC---UAGCG------GAUGUAAAA------------CGCC--AGUUAAAUAUAACUGCAAAAAAUACAAAU------------------------------------------------------UCUUACGCAGUAGCUGCCUAA------------------AAACCAGCCUGUGU----------------------------GAUCAAUAACAAAUU-------------------GCUUGUGUUUGUUGAUUGGUCUUAUUGUUA-------------------------------------------------------ACAAGCUAC---GUUAGAACUGA--------------GUCAGG--CUGUUCUAAA-AGAGUUCU---ACUGAC-UC----GCAU-CGUUAG--AGUUUGAGUUAUGUAUUGUAACGGUGU----UAAAUAAAC------ACAUAACCUAUAGU-UGUAG-----------------------ACAAAUGGGUU----AGCAGAUGUUUGGAC-GUGGGUUCGACUCCCAC-CGGCUCCAuua Smu102t67
Sgo1t1      GGGGUCG-----UUACGGA--UUCGACAGGCAUUAU------GAGGCAUAUUUUGCGACU--CAUC---UAGCG------GAUGUAAAA------------CGCC--AGUUAAAUAUAACUGCAAAAAAUAAUACU------------------------------------------------------UCUUACGCUUUAGCUGCCUAA------------------AAACCAGCGGGCGU----------------------------GACCCGAUUCGGAUU-------------------GCUUGUGUCUGAUGACAGGUCUUAUUAUUA-------------------------------------------------------GCAAGCUAC---GGUAGAAUCUU--------------GUCUAG--UGAUUUUACA-AGAGAUUG---AUAGAC-UC----GCUU-GAUUUG--GGCUUGAGUUAUGUGUCAAAAUCAAGU----UAAAACAAU------ACAUAGCCUAUGGU-UGUAG-----------------------ACAAAUGUGUU----GGCAGAUGUUUGGAC-GUGGGUUCGACUCCCAC-CGGCUCCAuau Sgo1t1
Spn256t59   GGGGUCG-----UUACGGA--UUCGACAGGCAUUAU------GAGGCAUAUUUUGCGACU--CGUG---UGGCG-------ACGUAAA-------------CGCU-CAGUUAAAUAUAACUGCAAAAAAUAACACU------------------------------------------------------UCUUACGCUCUAGCUGCCUAA------------------AAACCAGCAGGCGU----------------------------GACCCGAUUUGGAUU-------------------GCUCGUGUUCAAUGACAGGUCUUAUUAUUA-------------------------------------------------------GCGAGAUAC---GAUUAAGCCUU--------------GUCUAG--CGGUUUGAUA-AGAGAUUG---AUAGAC-UC----GCAG-UUUCUA--GACUUGAGUUAUGUGUCGAGGGGCUGU----UAAAAUAAU------ACAUAACCUAUGGU-UGUAG-----------------------ACAAAUAUGUU----GGCAGGUGUUUGGAC-GUGGGUUCGACUCCCAC-CGGCUCCAuua Spn256t59
Spn221t159  GGGGUCG-----UUACGGA--UUCGACAGGCAUUAU------GAGGCAUAUUUUGCGACU--CGUG---UGGCG-------ACGUAAA-------------CGCU-CAGUUAAAUAUAACUGCAAAAAAUAACACU------------------------------------------------------UCUUACGCUCUAGCUGCCUAA------------------AAACCAGCAGGCGU----------------------------GACCCGAUUUGGAUU-------------------GCUCGUGUUCAAUGACAGGUCUUAUUAUUA-------------------------------------------------------GCGAGAUAC---GAUUAAGCCUU--------------GUCUAG--CGGCUUGAUA-AGAGAUUG---AUAGAC-UC----GCAG-UUUCUA--GACUUGAGUUAUGUGUCGAGGGGCUGU----UAAAAUAAU------ACAUAACCUAUGGU-UGUAG-----------------------ACAAAUAUGUU----GGCAGGUGUUUGGAC-GUGGGUUCGACUCCCAC-CGGCUCCAuua Spn221t159
Spn45t12    GGGGUCG-----UUACGGA--UUCGACAGGCAUUAU------GAGGCAUAUUUUGCGACU--CGUG---UGGCG-------ACGUAAA-------------CGCU-CAGUUAAAUAUAACUGCAAAAAAUAACACU------------------------------------------------------UCUUACGCUCUAGCUGCCUAA------------------AAACCAGCAGGCGU----------------------------GACCCGAUUUGGAUU-------------------GCUCGUGUUCAAUGACAGGUCUUAUUAUUA-------------------------------------------------------GCGAGAUAC---GAUUAAGCCUU--------------GUCUAG--CGGCUUGAUA-AGAGAUUG---AUAGAC-UC----GCAG-UUUCUA--GACUUGAGUUAUGUGUCGAGGGGUUGU----UAAAAUAAU------ACAUAACCUAUGGU-UGUAG-----------------------ACAAAUAUGUU----GGCAGGUGUUUGGAC-GUGGGUUCGACUCCCAC-CGGCUCCAuua Spn45t12
Smi3t3      GGGGUCG-----UUACGGA--UUCGACAGGCAUUAU------GAGGCAUAUUUUGCGACU--CGUG---UGGCG-------ACGUAAA-------------CGCU-CAGUUAAAUAUAACUGCAAAAAAUAACACU------------------------------------------------------UCUUACGCUCUAGCUGCCUAA------------------AAACCAGCAGGCGU----------------------------GACCCGAUUUGGAUU-------------------GCUCGUGUUCAAUGACAGGUCUUAUUAUUA-------------------------------------------------------GCGAGAUAC---GAUCAAGCCUU--------------GUCUAG--CGGCUUGAUA-AGAGAUUG---AUAGAC-UC----GCGG-UUUCUA--GGCUUGAGUUAUGUGUCGAGGGACUGU----UAAACGAAU------ACAUAACCUAUGGU-UGUAG-----------------------ACAAAUAUGUU----AGCAGAUGUUUGGAC-GUGGGUUCGACUCCCAC-CGGCUCCAuug Smi3t3
Scr1t1      GGGGUCG-----UUACGGA--UUCGACAGGCAUUAU------GAGGCUUGUUUUGCAACC--CAUC---GGCAG-------AUGUCAAAA-----------UGCC--AGUUAAAUAUAACUGCAAAAAAUACAAAU------------------------------------------------------UCUUACGCAGUAGCUGCCUAA------------------ACACCAGCCUGUGU----------------------------GACUAAUAGCAGAUU-------------------GCUUGUGUUUGCCUAUUAGUCUUAAAAUCA-------------------------------------------------------GCAAGCUAC---AUUAGGUUGCA--------------GUCAGG--UCAGCCUAAA-AGAGAUUU---ACUGAC-UC----GCAA-GAUUUG--GGCUUGAGUUAUGUGUCGAGGUCUUGU----UAAACCAAU------ACAUAACCUAUGGU-UGUAG-----------------------ACGAAUAAGUU----AGCAGGUGUUUGGAC-GUGGGUUCGACUCCCAC-CGGCUCCAuag Scr1t1
Sth4t2      NNNNNNN-----NNNNNNN--NNNNNNNNNCAUUAU------GAGGCAUAUUCUGCGACU--CGUG---UGGCG-------ACGUUAA-------------CGCU-CAGUUAAAUAUAACUGCAAAAAAUACUAAU------------------------------------------------------UCUUACGCUGUAGCAGCCUAA------------------ACACCUGCUCGCGU----------------------------GACUUCUAGCAGAUU-------------------GCUUAUGUUUGUUUAGAAGUUUUAUUGAUUU------------------------------------------------------AUAAGCUAC---GUUCGAUCAUU--------------GCCUAG--CUGGUCGAAA-AGAGAUUU---AUAGGC-UC----GCAU-AUAGAA--GGCUUGAGUUAUGUGUCGCCUAUCUGU----UAAAUGAAAG-----ACAUAACCUAUGGU-CGUAG-----------------------ACGAAUAUGUU----GGCAGAUGCUUGGAC-GUNNNNNNNNNNNNNNN-NNNNNNNNNNN Sth4t2
Sth7t2      GGGGCCG-----UUACGGA--UUCGACAGGCAUUAU------GAGGCAUAUUCUGCGACU--CGUG---UGGCG-------ACGUUAA-------------CGCU-CAGUUAAAUAUAACUGCAAAAAAUACUAAU------------------------------------------------------UCUUACGCUGUAGCAGCCUAA------------------ACACCUGCUCGCGU----------------------------GACUUCUAGCAGAUU-------------------GCUUAUGUUUGUUUAGAGGUUUUAUUGAUUU------------------------------------------------------AUAAGCUAC---GUUCGAUCAUU--------------GCCUAG--CUGGUCGAAA-AGAGAUUU---AUAGGC-UC----GCAU-AUAGAA--GGCUUGAGUUAUGUGUCGUCUAUCUGU----UAAAUGAAAG-----ACAUAACCUAUGGU-CGUAG-----------------------ACGAAUAUGUU----GGCAGAUGCUUGGAC-GUGGGUUCGACUCCCAC-CGGCUCCAuaa Sth7t2
Sth5t5      GGGGUCG-----UUACGGA--UUCGACAGGCAUUAU------GAGGCAUAUUCUGCGACU--CGUG---UGGCG-------ACGUUAA-------------CGCU-CAGUUAAAUAUAACUGCAAAAAAUACUAAU------------------------------------------------------UCUUACGCUGUAGCAGCCUAA------------------ACACCUGCUCGCGU----------------------------GACUUCUAGCAGAUU-------------------GCUUAUGUUUGUUUAGAGGUUUUAUUGAUUU------------------------------------------------------AUAAGCUAC---GUUCGAUCAUU--------------GCCUAG--CUGGUCGAAA-AGAGAUUU---AUAGGC-UC----GCAU-AUAGAA--GGCUUGAGUUAUGUGUCGCCUAUCUGU----UAAAUGAAAG-----ACAUAACCUAUGGU-CGUAG-----------------------ACGAAUAUGUU----GGCAGAUGCUUGGAC-GUGGGUUCGACUCCCAC-CGGCUCCAuaa Sth5t5
Lra1t1      NNNNNNN-----NNNNNNN--NNNNNNNNNUGUUGU------CGCGUAUGAGCUGCGAUU--AGUG---CGGCGC-----CACUCUAAAC-----------CGCCGCAGAUAAAUAUAACUGCUAAAAAUACACAA------------------------------------------------------ACUUACGCAGUAGCUGCCUAA------------------ACCACAGCCUGCGU----------------------------GCCUGACUUUCGCUC-------------------GCCUAUGGCGAUUUGAUGGCCUAAUUUA---------------------------------------------------------GUAGGAUAC---GAUUUGACGGU--------------GUCUUG--ACGUCAGAGA-AGAGAUUA---AGAGAC-UC----GCAAGUUAACUU-UGUUCGAGGAUUGUCUCGUUAGCUUGU----UAAAUUUAG------ACAGUCCCUAUGAU-UGUAG-----------------------ACGCUGAUAUA----GCAAGGCAUUUGGAC-AGNNNNNNNNNNNNNNN-NNNNNNNNNNN Lra1t1
Lpl7t1      NNNNNNN-----NNNNNNN--NNNNNNNNNUGUUGU------CGCGUAUGAGCUGCGAUU--AGUGA---GACG-----UCACUCUAAAC-----------CGUCGCAGAUAAAUAUAACUGCUAAAAAUACACAA------------------------------------------------------ACUUACGCUUUAGCUGCCUAA------------------ACCACAGCCGGCGU----------------------------GCCAGACUUUCGUUC-------------------GCCUAUGACGAUUUGAUGGCCUAAUUUA---------------------------------------------------------GUAGGAUAC---GCUUUUGUGGU--------------GUCUUG--ACAUGAAAGA-AGAGAUUA---AGAGAC-UC----GCCAGCUGACUU-UGUUCGAGGAUUGUCUUGUCAGUUGGG----UAAAUUUAG------ACAGUCCCUAUGAU-UGUAG-----------------------ACGCUGAUAUA----GCAAGGCAUUUGGAC-AGNNNNNNNNNNNNNNN-NNNNNNNNNNN Lpl7t1
Lga8t10     NNNNNNN-----NNNNNNN--NNNNNNNNNCAUUGU------CGCGCAUGAACUGCAACU--GGUGG--UGAUG-----UCACCUAAAUC-----------CAUCGCAGAUAAAUAUAACUGCUAAAAAUAACACU------------------------------------------------------UCUUACGCACUCGCUGCCUAA------------------ACACCAGCUUGCGU----------------------------AGCUGAUGAUCGUUC-------------------GCCGAUGGCGGCCUGAAGCUCUAAACCUCA-------------------------------------------------------GUCGGAUAC---GUUUUUAUGGUG-------------GCUUUA---CAUAAAAAA-AGAGAUUU---UAAAGCACC----GCAAAUUUCUGC-UGUUUGAGACUGGCUUUGGAAAUUUGU----UAAACUAGA------GAAAGUCCUAUGGU-UGUAG-----------------------ACGUUGAUGUA----GCAAGGUGUCUGGAC-AGNNNNNNNNNNNNNNN-NNNNNNNNNNN Lga8t10
Lla11t2     GGGGGCG-----UUACGGA--UUCGACAGGCAUUGU------CGCGCAUGAACUGCAACU--GCUGA---GGGA-----UCAGGAUAAUC-----------AUCCGCAGAUAAAUAUAACUGCUAAAAAUAAUACA---------------------------------------------------CAAACUUACGCAAUGGCAGCCUAA------------------ACAGCACCAUGCGU----------------------------GCCUGAUUUUUGCUC-------------------UCUGAUGGCAAUUUGACGGCCUAAACUUUUA------------------------------------------------------GUCAGAUAC---GUUGUUGUGGA--------------GGCUUG--ACGCAGCAAA-AGAGAUUU---AAAGCC-CC----GCAAAAUGUCGC-UGUUUGAGACUGGCUUUGGCAUUUUGU----UAAAUUUGA------GAAAGUCCUAUGGU-UGUAG-----------------------ACGUUGAUGUA----GCAAGGUGUUUGGAC-AGGGGUUCGACUCCCCU-CGCCUCCAuug Lla11t2
Lla4t7      GGGGGCG-----UUACGGA--UUCGACAGGCAUUGU------CGCGCAUGAACUGCAACU--GCUGA---GGGA-----UCAGGAUAAUC-----------AUCCGCAGAUAAAUAUAACUGCUAAAAAUAAUACA---------------------------------------------------CAAACUUACGCAAUGGCAGCCUAA------------------ACAGCACCAUGCGU----------------------------GCCUGAUUUUUGCUC-------------------ACUGAUGGCAAUUUGACGGCCUAAACUUUUA------------------------------------------------------GUCAGAUAC---GUUGUUGUGGA--------------GACUUG--ACGCAGCAAA-AGAGAUUU---AAAGUC-CC----GCAAAAUGUCGC-UGUUUGAGACUGGCUUUGGCAUUUUGU----UAAAUUUGA------GAAAGUCCUAUGGU-UGUAG-----------------------ACGUUGAUGUA----GCAAGGUGUUUGGAC-AGGGGUUCGACUCCCCU-CGCCUCCAuua Lla4t7
Lla14t8     NNNNNNN-----NNNNNNN--NNNNNNNNNCAUUGU------CGCGCAUGAACUGCAACU--GCUGA---GGGA-----UCAGGAUAAUC-----------AUCCGCAGAUAAAUAUAACUGCUAAAAAUAAUACA---------------------------------------------------CAAACUUACGCAAUGGCAGCCUAA------------------ACAGCACCAUGCGU----------------------------GCCUGAUUUUUGCUC-------------------ACUGAUGGCAAUUUGACGGCCUAAACUUUUA------------------------------------------------------GUCAGAUAC---GUUGUUGUGGA--------------GGCUUG--ACGCAGCAAA-AGAGAUUU---AAAGCC-CC----GCAAAAUGUCGC-UGUUUGAGACUGGCUUUGGCAUUUUGU----UAAAUUUGA------GAAAGUCCUAUGGU-UGUAG-----------------------ACGUUGAUGUA----GCAAGGUGUUUGGAC-AGNNNNNNNNNNNNNNN-NNNNNNNNNNN Lla14t8
Lla8t1      NNNNNNN-----NNNNNNN--NNNNNNNNNCAUUGU------CGCGCAUGAACUGCAACU--GCUGA---GGGA-----UCAGGAUAAUC-----------AUCCGCAGAUAAAUAUAACUGCUAAAAAUAAUACA---------------------------------------------------CAAACUUACGCAAUGGCAGCCUAA------------------ACAGCACCAUGCGU----------------------------GCCUGAUUUUUGCUC-------------------ACUGAUGGCAACUUGACGGCCUAAACUUUUA------------------------------------------------------GUCAGAUAC---GUUGUUGUGGA--------------GGCUUG--ACGCAGCAAA-AGAGAUUU---AAAGUC-CC----GCAAAAUGUCGC-UGUUUGAGACUGGCUUUGGCAUUUUGU----UAAAUUUGA------GAAAGUCCUAUGGU-UGUAG-----------------------ACGUUGAUGUA----GCAAGGUGUUUGGAC-AGNNNNNNNNNNNNNNN-NNNNNNNNNNN Lla8t1
ACTINOBACTERIA
Ana1t1      GGGGAUG------AUCGGU--UUCGACGACGGUCGUA-----GGUUCAGGAGAAGCGGGU--CGAGG-AUGCGCAGUCAUCUCG----UCAACGC----UCUGCGCG---AACCAAUAGGUGCCGAUAACACUCGC---------------------------------------------------ACCGACUUCGCCCUCGCCGCCUGA------------------------GCGAGCCUCGAAGUC---------------------CGUCAGCCCGGGGAAC-----------------GCUUCCGCCCCGGUUCCUGGCGUCAUCUA---------------------------------------------------------GGAAGCCACU--GCUGAGAGCCCGU------------GUCGGUAGGGCUCU-CGGGACUUUUC-----AUCGACUG------AGCCCGU-CGGCGUCCUUGCUCGCGUGAGACGCCGGGGCU---GAGAAAAACGCUA---GCGAGCUGCACC-CGGAG-----------------------AAGUCCUGUUG-----UGCGGCCGUCGGAC-GGGGGUUCGAUUCCCCC-CAUCUCCACga Ana1t1
Bli2t1      GGGGAUG------AUCGGU--UUCGACGUCGGACACU-----GCGACGGGAGAAGCGGGC--CGAGA-AUGUAGAGUCAUCUCG---UUAAU-------GUCCUCUGCA-AAACAAUAGGUGCUAAGUCUAAUAAC------------------------------------------------CGCACCGAUUUCGCCCUCGCUGCCUGA------------------------UUAGGCCGAGCUGCGAAUC-----------------CGUCAGUCUAGAGUU------------------GCUUCCACUCUAGGUCCUGGCGUCGCUUA---------------------------------------------------------GGGAGCCACU--GCUUCAGAUAUUU------------GUUGAGGGUAUCUG-AGGGACUUUUA-----CUCAACUC------CGUUCGUUGGUCCACAUGUUCGUGUGA-GGGCCAGAACC----UAAGAAACUACUU--CACGAACUGCGCC-CGGAG-----------------------AAGUCCUGACA-----AUCUGCCGACGGAC-GCGGGUUCGAUUCCCGC-CAUCUCCACCc Bli2t1
Afb1t1      GGGGAUG------AUCGGU--UUCGACGAUGUUAGUC-----GCGACAGGUGAAGCGGGC--CGAGG-AUGCAGAAUUAUCUCG---UAAAC-------GCUGUCUGCA-AAACAAUAAGUGCCAAACAAACGCGC---------------------------------------------------ACUGACUUCGCUCUCGCUGCCUAA------------------------GCAGUAAGACAGUC----------------------CGUCAGCCCGGGAUU------------------GCUAUCGUCCCGGUUCCUGGCGUCAUUA---------------------------------------------------------AGAUAGCCACU--GCUGUUUACCUUC------------GUCAUUGGGGUGAA-CGGGACUCUUA-----GAUGACUG------GGCCCGGAUCAGCUACUUGUUUGCAGGAUAGCUGGGGCC----GAGAAAAUCCGA---CGCAAACUGCGCC-CGGAG-----------------------AAGCCCUGACA-----ACACGACAUCGGAC-GGGGGUUCAAUUCCCCC-CAUCUCCACCA Afb1t1
Ssi1t1      NNNNNNN------NNNNNN--NNNNNNNNNNNNNNNN-----NNNNNNNNNNNNNNNNNN--NNNNN-NNNNNNNNNNNNNNNN---NNNNN-------NNNNNNNNNN-NNNNNNNNNNNNNNNNNNNNNNNNNN---------------------------------------------------NNNNNNNNNNNNNNNNNNNNNNNN------------------------NNNNNNNNNNNNNN----------------------NNNNNNNNNNNNNNN------------------NNNNNNNNNNNNNNNNNNNNNNNNNNNN---------------------------------------------------------NNNNNNNNNNN--NNNNNNNNNNNNN------------NNNNNNNNNNNNNN-NNNNNNNNNNN-----NNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN----NNNNNNNNNNNN---NNNNNNNNNNNNN-NNNNN-----------------------NNCCGGCGUAU-----UGGAGCUUCUGGAC-GUGGGUUCGACUCCCAC-CGUCUCCAuau Ssi1t1
Twh16t17    GGGGAUG------ACUGGU--UUCGACGCUGUUUGUG-----UACUCGUGGGAAGCGGGU--CGAGG-AUGCGAGGUUGUCUCG---UUAAC-------GAUCCUCGCA--AAAUAUAAGUGCCAACUUAAAGCGC---------------------------------------------------ACUGAUCUAAGUCUUGCUGCUUAA------------------------GCGCUUAGAUC-------------------------UGUCGGUAUAGGGCUU-----------------GUCUUCGGCCCUGUAUCCGGCAUGGUUUU--------------------------------------------------------AGAGGACUU----GCCGCGUGUUUGCC-----------GCUUGCGUGAACAC-CGGGACUUUAUU----GCAAGCUG------GGCCUGUUGAUUUAGAUUCCGCUGCAAAGAAUCAGGGCU----GAGUAUAACGGUUU-UAGCGGAUACACC-CGUAG-----------------------AAGUCACGGGC-----UCCAUGCCGCGGAC-GGGGGUUCGAUUCCCCC-CAUCUCCACug Twh16t17
Cmi2t1      GGGGAUG------AUCGGU--UUCGACAUUGCCUGAA-----UGACUGCGAGAAGCGGGU--CGAGG-AUGCAGGGCUAUCUCG---UAAAC-------GCUCUCUGCA--AAAUACAACUGCCAAUAACAAGCAG---------------------------------------------------UCGUCCUUUGUUCUCGCUGCCUAA-------------------GCGAGCGCACUAACAGGAC----------------------CGUCGACCCGGUGAU------------------GCUCUCUAUCCGGUAAGUCGGCGUCAGAA-------------------------------------------------------AAGGGAGCUC----GCUGCGCGGUCGU------------GCCUCAGGGCCGCG-CGGGACUCGAA----CUGAGGCUG------GGCCCGUCGGAUCAGAUGCCAGGAGCAAGUUCCGGGGCC----GAGCAGGACGCCUU-UCCUGGAUACACC-CGUAG-----------------------AAGGCGCAGGA-----UUACAGCAGUGGAC-CGGGGUUCGAUUCCCCG-CAUCUCCACCA Cmi2t1
Lxy1t1      GGGGAUG------AUCGGU--UUCGACAUUGUCUGCG-----UGAGUAUGAGAAGCGGGU--CGAGG-ACGCAUGGUUAUCUCG---UUAAC-------GAUCCAUGCA--AAAAAUAAGUGCCAAUUCCAAGAGC------------------------------------ACUGUCUCGGCCAAGGCCGACUUCGCCCUCGCGGCGUAA-------------GUUCACCUCAGCCAUCUGAAGAGGC----------------------CGUCAGACCGGGAACU-----------------GUUCUCUACCCGGAGCCUGGCGUCAGUG---------------------------------------------------------AGAGAACUC----GCUUCUGCGUUGA------------GUAUCAGGGCGCAG-AGGGACUUCAA----CUGAUACUA------GGCCCGCCGGAACAGGUGCCAGCGACACGUUCCGGGGCC----GAGAAAGCGACA---CACUGGCUACGCC-CGUAG-----------------------AAGGCAUAUGA-----CCACAGCAGUGGAC-GGGGGUUCGAUUCCCCC-CAUCUCCACCA Lxy1t1
Cdi42t7     GGGGCUG----AUUUUGGU--UUCGACUGCGUGCAUU-----AAGCUAGGGGAAGCGUGC--CGGUGCAGGCUAGAGACCACCGAUUUUAAG-------CGUCGUAGC-AAAUAUAUAAGCGCAGAGAACACUCAG---------------------------------------------------CGCGACUACGCCCUCGCUGCCUAA------------------UUUGCAGCGACCUGCGUGUC----------------------UGUCAGCCUAGAUUC------------------GUCUCUGGUUUAGUGUCUGGCAUCGAUUA---------------------------------------------------------AGAGACUU----GCUGGUUUGUUGU------------GUCAACGGGGCAAACUGGGAC--UUUCA-CCGAUGACUG------GGCUCAUCAUCCGGGUGUGUUCGUCCAAGCCGGAGAGCC----GAGUAGAGAUCCACGCGCGAACUGCGCA-CGGAG-----------------------AAGCCCUAGCG-----AGGUGACGUAGGAC-CCGGGUUCAAUUCCCGG-CAGCUCCACCA Cdi42t7
Cgl3t7      GGGGCUG-----ACAUGGU--UUCGACUACGUUGAUU-----UAGCCAGGGGAAGCGUGC--CGGUGAAGGCUGGAGACCACCG----UAAG-------CGUCGCAGC-AAACCAAUAAGCGCCGAGAAGUCUCAG---------------------------------------------------CGCGACUACGCCCUCGCUGCAUAA--------------------GCAAGCGACC-GCGUGUC----------------------UGUCAGCCUAGGGAA------------------GUCCCUGACCUAGAUCCUGGCAUCGACUA---------------------------------------------------------AGGGACUU----GCUGUUCAAUCGC------------GUCAGCGGGGUUGAACAGGAC--UUUUA-CCGUUGACUG------GGCUCAUCAUCCGGAAGUGUUCGUCCUAGCCGGAGGGCC----AAGCAGAGAUCUUUGCGCGAACUGCGCA-CGGAG-----------------------AAGCCCUGGCG-----AGGUGACGUAGGAC-CCGGGUUCAAUUCCCGG-CAGCUCCACCg Cgl3t7
Cef1t3      GGGGCUG-----ACAUGGU--UUCGACUACGUUGAUU-----GAGCCAGGGGAAGCGUGC--CGGUGAAGGCUGGAGACCACCG----UGAG-------CGUCGCAGC-AAACCAAUAAGCGCCGAGAAGACUCAG---------------------------------------------------CGCGACUACGCCCUCGCUGCCUAA--------------------GU-AGCGACC-GCGUGUC----------------------UGUCAGCCCGGGGAU------------------GUCCCUGCCCCGGAUGCUGGCAUCGACUA---------------------------------------------------------AGGGACUU----GCUAUCCAACCGC------------GUCAGCGGGGUUGGAUGGGAC--UUCUA-CCGCUGACUG------GGCCCAUCAUCCGGAUGUGUUCGUCCUAGCCGGAGGGCC----AAGCAGAGAUCGCUGCACGAACUGCGCA-CGGAG-----------------------AAGCCCUGGCA-----AAGUAGCGUAGGAC-CCGGGUUCAAUUCCCGG-CAGCUCCACga Cef1t3
Gru1t2      NNNNNNN------NNNNNN--NNNNNNUGCGUACGUU-----GAGGUAGGGGAAGCGUGU--CGGUGCAGGCAAGAGACCACCG----UAAG-------CGUCGCUGC-AAACAUAUAAGCGCCGAUUCCAAUCAG---------------------------------------------------CGCGACUACGCACUCGCUGCCUAA------------------------GUAGC-GACUGCG-----------------------UGUCUGUCAGUCCGGGUUC--------------GCCCUCGGCCCGGGUACUGGCAUCAGCUA---------------------------------------------------------GAGGGCUUU---ACCGUUCGACUC-------------GGUCGCGGAGUCGAACGGGACAACCAACA---GCGACUG------GGAUCGUCAUCCUGGCUUGUUUGCGAGACUGGGAGAUCC----AAGUAGAGACAUA---GCAAACUGCACA-CGGAG-----------------------AAGCCCUAGCU-----UUGCUGCGGAGGAC-CCGGNNNNNNNNNNNNN-NNNNNNNNNNN Gru1t2
Mav2t1      GGGGCUG------AAAGGU--UUCGACUUCGCGCAUC-----GAAUCAAGGGAAGCGUGC--CGGUGCAGGCAACUGACCACCG----UAAG-------CGUCGUUGC-AAAUAGAUAAGCGCCGAUUCACAUCAG---------------------------------------------------CGCGACUACGCUCUCGCUGCCUAA------------------------GCGAC-AGCUAGUC----------------------CGUCAGCCCGGGAAC------------------GCCCUCGACCCGGAGCCUGGCGUCAGCUA---------------------------------------------------------GAGGGAUCC---ACCGAUGAGUUC-------------GGUCGCGGGACUCAUCGGGACACCAACA----GCGACUG------GGAUCGUCAUCCUGGCUUGUUCGCGUGACCAGGAGAUCC----GAGUAGAGGCAUA---GCGAACUGCGCA-CGGAG-----------------------AAGCCUUGAGG-----GAAUGCCGUAGGAC-CCGGGUUCGAUUCCCGG-CAGCUCCACug Mav2t1
Mav15t23    GGGGCUG------AAAGGU--UUCGACUUCGCGCAUC-----GAAUCAAGGGAAGCGUGC--CGGUGCAGGCAACUGACCACCG----UAAG-------CGUCGUUGC-AAAUAGAUAAGCGCCGAUUCACAUCAG---------------------------------------------------CGCGACUACGCUCUCGCUGCCUAA------------------------GCGAC-AGCUAGUC----------------------CGUCAGCCCGGGAAC------------------GCCCUCGACCCGGAGCCUGGCGUCAGCUA---------------------------------------------------------GAGGGAUCC---ACCGAUGAGUUC-------------GGUCGCGGGACUCAUCGGGACACCAACA----GCGACUG------GGAUCGUCAUCCUGGCUUGUUCGCGUGACCAGGAGAUCC----GAGUAGAGGCAUA---GCGAACUGCGCA-CGGAG-----------------------AAGCCUUGAGG-----GAAUGCCGUAGGAC-CCGGGUUCGAUUCCCGG-CAGCUCCACCg Mav15t23
Min3t6      NNNNNNN------NNNNNN--NNNNACUUCGCGCAUC-----GAAUCAAGGGAAGCGUGC--CGGUGCAGGCAACCGACCACCG----UAAG-------CGUCGUUGC-AAACAGAUAAGCGCCGAUUCACAUCAG---------------------------------------------------CGCGACUACGCUCUCGCUGCCUAA------------------------GCGAC-AGCUAGUC----------------------CGUCAGACCGGGAAC------------------GCCCUCGACCCGGAGCCUGGCGUCAGCUA---------------------------------------------------------GAGGGAUCC---ACCGAUGAGUCC-------------GGUCGCGGGACUUAUCGGGACACCAACA----GCGACUG------GGAUCGUCAUCUCGGCUUGUUCGCGUGACCGGGAGAUCC----GAGUAGAGGCAUA---GCGAACUGCGCA-CGGAG-----------------------AAGUCUUGAGG-----GAAUGCCGUAGNNN-NNNNNNNNNNNNNNNNN-NNNNNNNNNNN Min3t6
Mtu23t125   GGGGCUG------AACGGU--UUCGACUUCGCGCAUC-----GAAUCAAGGGAAGCGUGC--CGGUGCAGGCAAGAGACCACCG----UAAG-------CGUCGUUGC-GACCAAAUAAGCGCCGAUUCACAUCAG---------------------------------------------------CGCGACUACGCUCUCGCUGCCUAA------------------------GCGAC-GGCUAGUC----------------------UGUCAGACCGGGAAC------------------GCCCUCGGCCCGGACCCUGGCAUCAGCUA---------------------------------------------------------GAGGGAUCC---ACCGAUGAGUCC-------------GGUCGCGGGACUCCUCGGGACAACCACA----GCGACUG------GGAUCGUCAUCUCGGCUAGUUCGCGUGACCGGGAGAUCC----GAGCAGAGGCAUA---GCGAACUGCGCA-CGGAG-----------------------AAGCCUUGAGG-----GAAUGCCGUAGGAC-CCGGGUUCGAUUCCCGG-CAGCUCCACCg Mtu23t125
Mtu23t125   GGGGCUG------AACGGU--UUCGACUUCGCGCAUC-----GAAUCAAGGGAAGCGUGC--CGGUGCAGGCAAGAGACCACCG----UAAG-------CGUCGUUGC-GACCAAAUAAGCGCCGAUUCACAUCAG---------------------------------------------------CGCGACUACGCUCUCGCUGCCUAA------------------------GCGAC-GGCUAGUC----------------------UGUCAGACCGGGAAC------------------GCCCUCGGCCCGGACCCUGGCAUCAGCUA---------------------------------------------------------GAGGGAUCC---ACCGAUGAGUCC-------------GGUCGCGGGACUCCUCGGGACAACCACA----GCGACUG------GGAUCGUCAUCUCGGCUAGUUCGCGUGACCGGGAGAUCC----GAGCAGAGGCAUA---GCGAACUGCGCA-CGGAG-----------------------AAGCCUUGAGG-----GAAUGCCGUAGGAC-CCGGGUUCGAUUCCCGG-CAGCUCCACCg Mtu23t125
Mtu23t125   GGGGCUG------AACGGU--UUCGACUUCGCGCAUC-----GAAUCAAGGGAAGCGUGC--CGGUGCAGGCAAGAGACCACCG----UAAG-------CGUCGUUGC-GACCAAAUAAGCGCCGAUUCACAUCAG---------------------------------------------------CGCGACUACGCUCUCGCUGCCUAA------------------------GCGAC-GGCUAGUC----------------------UGUCAGACCGGGAAC------------------GCCCUCGGCCCGGACCCUGGCAUCAGCUA---------------------------------------------------------GAGGGAUCC---ACCGAUGAGUCC-------------GGUCGCGGGACUCCUCGGGACAACCACA----GCGACUG------GGAUCGUCAUCUCGGCUAGUUCGCGUGACCGGGAGAUCC----GAGCAGAGGCAUA---GCGAACUGCGCA-CGGAG-----------------------AAGCCUUGAGG-----GAAUGCCGUAGGAC-CCGGGUUCGAUUCCCGG-CAGCUCCACCg Mtu23t125
Mtu23t125   GGGGCUG------AACGGU--UUCGACUUCGCGCAUC-----GAAUCAAGGGAAGCGUGC--CGGUGCAGGCAAGAGACCACCG----UAAG-------CGUCGUUGC-GACCAAAUAAGCGCCGAUUCACAUCAG---------------------------------------------------CGCGACUACGCUCUCGCUGCCUAA------------------------GCGAC-GGCUAGUC----------------------UGUCAGACCGGGAAC------------------GCCCUCGGCCCGGACCCUGGCAUCAGCUA---------------------------------------------------------GAGGGAUCC---ACCGAUGAGUCC-------------GGUCGCGGGACUCCUCGGGACAACCACA----GCGACUG------GGAUCGUCAUCUCGGCUAGUUCGCGUGACCGGGAGAUCC----GAGCAGAGGCAUA---GCGAACUGCGCA-CGGAG-----------------------AAGCCUUGAGG-----GAAUGCCGUAGGAC-CCGGGUUCGAUUCCCGG-CAGCUCCACCg Mtu23t125
Mtu4t1      GGGGCUG------AACGGU--UUCGACUUCGCGCAUC-----GAAUCAAGGGAAGCGUGC--CGGUGCAGGCAAGAGACCACCG----UAAG-------CGUCGUUGC-GACCAAAUAAGCGCCGAUUCACAUCAG---------------------------------------------------CGCGACUACGCUCUCGCUGCCUAA------------------------GCGAC-GGCUAGUC----------------------UGUCAGACCGGGAAC------------------GCCCUCGGCCCGGACCCUGGCAUCAGCUA---------------------------------------------------------GAGGGAUCC---ACCGAUGAGUCC-------------GGUCGCGGGACUCCUCGGGACAACCACA----GCGACUG------GGAUCGUCAUCUCGGCUAGUUCGCGUGACCGGGAGAUCC----AAGCAGAGGCAUA---ACGAACUGCGCA-CGGAG-----------------------AAGCCUUGAGG-----GAAUGCCGUAGGAC-CCGGGUUCGAUUCCCGG-CAGCUCCACCg Mtu4t1
Mle3t4      GGGGCUG------AAAGGU--UUCGACUUCGCGCAUC-----GAAUCAAGGGAAGCGUGC--CGGUGCAGGCAAGAGACCACCG----UAAG-------CGUCGUUGC-AGCAAUAUAAGCGCCGAUUCAUAUCAG---------------------------------------------------CGCGACUAUGCUCUCGCUGCCUAA------------------------GCGAU-GGCUAGUC----------------------UGUCAGACCGGGAAC------------------GCCCUCGUCCCGGAGCCUGGCAUCAGCUA---------------------------------------------------------GAGGGAUCU---ACCGAUGGGUUC-------------GGUCGCGGGACUCGUCGGGACACCAAC----CGCGACUG------GGAUCGUCAUCCUGGCUAGUUCGCGUGAUCAGGAGAUCC----GAGUAGAGGCAUA---GCGAACUACGCA-CGGAG-----------------------AAGCCUUGAGG----GAAAUGCCGUAGGAC-CCGGGUUCGAUUCCCGG-CAGCUCCACCg Mle3t4
Mma12t7     GGGGCUG------AACGGU--UUCGACUUCGCGCAUC-----GAAUCAAGGGAAGCGUGC--CGGUGCAGGCAAGAGACCACCG----UAAG-------CGUCGAUGC-AACUAGAUAAGCGCCGAUUCACAUCAG---------------------------------------------------CGCGACUACGCUCUCGCUGCCUAA------------------------GCGAC-GGCUAGUC----------------------UGUCGGACCGGGAAC------------------GCCCUCGCCCCGGACCCCGGCAUCAGCUA---------------------------------------------------------GAGGGAUCA---ACCGAUGAGUUC-------------GGUCGCGGGGCUCAUCGGGACAUCAACA----GCGACUG------GGAUCGUCAUCCUGGCUAGUUCGCGUGACCAGGAGAUCC----GAGCAGAGACAUA---GCGGACUGCGCA-CGGAG-----------------------AAGCCUUGAGG-----GAAUGCCGUAGGAC-CCGGGUUCGAUUCCCGG-CAGCUCCACaa Mma12t7
Mma12t2     NNNNNNN------NNNNNN--NNNNACUUCGCGCAUC-----GAAUCAAGGGAAGCGUGC--CGGUGCAGGCAAGAGACCACCG----UAAG-------CGUCGAUGC-AACUAGAUAAGCGCCGAUUCACAUCAG---------------------------------------------------CGCGACUACGCUCUCGCUGCCUAA------------------------GCGAC-GGCUAGUC----------------------UGUCGGACCGGGAAC------------------GCCCUCGCCCCGGACCCCGGCAUCAGCUA---------------------------------------------------------GAGGGAUCA---ACCGAUGAGUUC-------------GGUCGCGGGGCUCAUCGGGACAUCAACA----GCGACUG------GGAUCGUCAUCCUGGCUAGUUCGCGUGACCAGGAGAUCC----GAGCAGAGACCUA---GCGGACUGCGCA-CGGAG-----------------------AAGCCUUGAGG-----GAAUGCCGUAGNNN-NNNNNNNNNNNNNNNNN-NNNNNNNNNNN Mma12t2
Msm2t4      GGGGCUG------AACGGU--UUCGACUUCGAGCAUC-----GAAUCCAGGGAAGCGUGC--CGGUGCAGGCAAGAGACCACCG----UAAG-------CGUCGUUGC-AACCAAUUAAGCGCCGAUUCCAAUCAG---------------------------------------------------CGCGACUACGCCCUCGCUGCCUAA------------------------GCGAC-GGCUGGUC----------------------UGUCAGACCGGGAGU------------------GCCCUCGGCCCGGAUCCUGGCAUCAGCUA---------------------------------------------------------GAGGGACCC---ACCCACGGGUUC-------------GGUCGCGGGACCUGUGGGGACAUCAAACA---GCGACUG------GGAUCGUCAUCUCGGCUUGUUCGUGUGACCGGGAGAUCC----GAGUAGAGACAUA---GCGAACUGCGCA-CGGAG-----------------------AAGCCUCGAGG-----ACAUGCCGUAGGAC-CCGGGUUCAAUUCCCGG-CAGCUCCACCA Msm2t4
Nfa1t1      GGGGCUG------AACGGU--UUCGACUGCGUACGUU-----GAUUCAGGGGAAGCGUGU--CGGUGCAGGCAAGAGACCACCG----UAAG-------CGUCGCUGC-AACCAAUUAAGCGCCGAUUCUCAUCAG---------------------------------------------------CGCGAGUACGCUCUCGCUGCCUAA------------------------GCGA--AGCGUCUC----------------------UGUCGGCCCGGGAUAU-----------------GCCCUCGGUCCCGGUGCCGGCAUCAGCUA---------------------------------------------------------GAGGGCUC----ACCGUCCGCCUC-------------GGUCGCGGAGACGGACGGGACAUCCAAC---AGCGACUG------GGAUCGUCAUCUCGGCUUGUUCGCGUGACCGAGAGAUCC----GAGCAGAGACACA---GCGAACUGCACA-CGGAG-----------------------AAGCCCUGAAG-----ACGCGGCGGAGGAC-CCGGGUUCGAUUCCCGG-CAGCUCCACga Nfa1t1
Req1t3      NNNNNNN------NNNNNN--NNNNNNUGCGUACGUU-----GAGCAAGGGGAAGCGUGU--CGGUGCAGGCAAGAGACCACCG----UAAG-------CGUCGCUGC-AACCAAUUAAGCGCCGAGUCCACUCAG---------------------------------------------------CGCGAGUACGCCCUCGCUGCCUAA------------------------GCGAG-CGCGUCUC----------------------UGUCAGCCCGGGUUU------------------GCUCUCGACCCGGAUCCUGGCAUCGACUA---------------------------------------------------------GAGAGCUCU---ACCGUACGGCUC-------------GGUCGCGGAGACGUGCGGGACAACAAAC---AGCGACUG------GGAUCGUCAUCUCGUCUUGUUCGCGAGAACGGGAGAUCC----GAGUAGAGACAUA---GCGAACUGCACA-CGGAG-----------------------AAGCCCUCGCG-----AGGCGGCGGAGGAC-CCGGNNNNNNNNNNNNN-NNNNNNNNNNN Req1t3
Pac74t4     GGGGAUG------ACUGGU--UUCGACUUGGAAUGGU----UGUUCCAGGAGAAGCGGGC--CGAGG-ACCCAGGGUCAACUCG----UUAAC------GAUCCUUGG-AAACCUAUAAGUGCCGAGAACACUCGC---------------------------------------------------ACUGACUUCGCUCUCGCUGCCUGA------------------------UCAGUGAUCGAAG-----------------------GGUCAGCCCGGAUGUA-----------------GCCUUCCGUCCGGAUCCUGGCCUCGUUUA---------------------------------------------------------GAAGGCUU----GCCGUACAGCUGU------------GGUCACGGGGGCUGUACGGGACGUUUA----CGUGACUG------GGCUUGU--CUGCACCAUGUCGGUGUGAGUGCAGGAGCC----GAGCAAUAACGACAGCAUCGACUGCGCC-CGGAG-----------------------AAUGUCUGGAC-----GGUCUUUCAAGGAC-GCGGGUUCAAUUCCCGC-CAUCUCCACua Pac74t4
Pac77t57    GGGGAUG------ACUGGU--UUCGACUUGGAAUGGU----UGUUCCAGGAGAAGCGGGC--CGAGG-ACCCAGGGUCAACUCG----UUAAC------GAUCCUUGG-AAACCUAUAAGUGCCGAGAACACUCGC---------------------------------------------------ACUGACUUCGCUCUCGCUGCCUGA------------------------UCAGUGAUCGAAG-----------------------GGUCAGCCCGGAUGUA-----------------GCCUUCCGUCCGGAUCCUGGCCUCGUUUA---------------------------------------------------------GAAGGCUU----GCCGUACAGCUGU------------GGUCACGGGGGCUGUACGGGACGUUUC----CGUGACUG------GGCUUGU--CUGCACCAUGUCGGUGUGAGUGCAGGAGCC----GAGCAAUAACGACAGCAUCGACUGCGCC-CGGAG-----------------------AAUGUCUGGAC-----GGUCUUUCAAGGAC-GCGGGUUCAAUUCCCGC-CAUCUCCACua Pac77t57
Spu3t1      gagcugu------agugca--gcguuuuccggacGGU----UGUUCCAGGAGAAGUGGGG--UGAGG-GCCCAGGGUCAACUUG----UUAAC------GAUCGUUGG-GAAUCUAUAAGUGCCGAGAAUACUCGC---------------------------------------------------ACUGACUUCGCUCUUGCUGCCUGA------------------------UCAGUGAUCGAAG-----------------------GGUCAGCCCGGAUU-----------------------------------CUGGUUUCGUUGC---------------------------------------------------------GAUGACUU----GCCGCCCAGUUGU------------UGUCGUGGUGACUGGGCGGAAUUAUUU---CUACGAUCG------AGUUUGU--UUGCACCAUGUCGGUGUGAGUGCAGGAGCC----GAGCAAUAACGACAGCAUCGACUGCGCC-CGGAA-----------------------AAUGUCUGGAC-----GGUCUUUCAAGGAC-GUGGGUUCAAUUCCUGC-C-UCUCCACua Spu3t1
Pac77t12    gagcugu------agugca--gcguuuuccggacGGU----UGUUCCAGGAGAAGUGGGG--UGAGG-GCCCAGGGUCAACUUG----UUAAC------GAUCGUUGG-GAAUCUAUAAGUGCCGAGAAUACUCGC---------------------------------------------------ACUGACUUCGCUCUUGCUGCCUGA------------------------UCAGUGAUCGAAG-----------------------GGUCAGCCCGGAUU-----------------------------------CUGGUUUCGUUGC---------------------------------------------------------GAUGACUU----GCCGCCCAGUUGU------------UGUCGUGGUGACUGGGCGGAAUUAUUU---CUACGAUCG------AGUUUGU--UUGCACCAUGUCGGUGUGAGUGCAGGAGCC----GAGCAAUAACGACAGCAUCGACUGCGCC-CGGAA-----------------------AAUGUCUGGAU-----GGUCUUUCAAGGAC-GUGGGUUCAAUUCCUGC-C-UCUCCACua Pac77t12
Sco4t7      GGGGAUG------AUCGGU--UUCGACAGCGGCUGUC-----GAAGCAGGGGAAGCGUGU--CGAGGAAGCGGCCAUGAUCUCGUAAACCAC-------AGGCCG-----AAAAAAUAAUCGCCAACACCAAGCGC---------------------------------------GAUUCCUCCCAGCAGGCCUUCGCCCUCGCUGCCUGA---------------UCUCAGGUAGCGAAGCGAGCCUCCUACUAAGGGAG----------UGUCAGCCCGGGGCU------------------GUUCCCGACCCGGAUCCUGGCAUCAGCUA---------------------------------------------------------GGGGACUAA---ACCUUGAUCCC--------------GGUCACGGGGUGAAGAGGGAAACCAAACA---GUGACUG------GGCCCGU--CGGAGACUUGUCCGCGUGAUCUCCGGGGCC----GAGAAAAU-CGAA---GCGGACUGCACA-CGGAG-----------------------AAGCCCUGAUU-----CCGCACCGUUGGAC-GCGGGUUCGAUUCCCGC-CAUCUCCACga Sco4t7
Sco4t7      GGGGAUG------AUCGGU--UUCGACAGCGGCUGUC-----GAAGCAGGGGAAGCGUGU--CGAGGAAGCGGCCAUGAUCUCGUAAACCAC-------AGGCCG-----AAAAAAUAAUCGCCAACACCAAGCGC---------------------------------------GAUUCCUCCCAGCAGGCCUUCGCCCUCGCUGCCUGA---------------UCUCAGGUAGCGAAGCGAGCCUCCUACUAAGGGAG----------UGUCAGCCCGGGGCU------------------GUUCCCGACCCGGAUCCUGGCAUCAGCUA---------------------------------------------------------GGGGACUAA---ACCUUGAUCCC--------------GGUCACGGGGUGAAGAGGGAAACCAAACA---GUGACUG------GGCCCGU--CGGAGACUUGUCCGCGUGAUCUCCGGGGCC----GAGAAAAU-CGAA---GCGGACUGCACA-CGGAG-----------------------AAGCCCUGAUU-----CCGCACCGUUGGAC-GCGGGUUCGAUUCCCGC-CAUCUCCACnn Sco4t7
Ssc1t1      GGGGAUG------AUCGGU--UUCGACAGCGGAUGUC-----GAGGCAGGGGAAGCGUGU--CGAGGAAGCGGCCACGAUCUCGUUAACCAC-------AGGCCG----AAAAAAAUAAUCGCCAAUUCCAAGAGC---------------------------------------GAUUCUCCGCAGCAGCAGUUCUCCCUCGCCGCCUGA---------------UCUCAGGUAGCGACGAGACUGCUCCUGCACUAAGGAG--------UGUCAGCCCGGGGCU------------------GUUCCCGACCCGGAUCCUGGCAUCAGCUA---------------------------------------------------------GGGGACUAA---ACCUUGAUCCC--------------GGUCACGGGGUGAAGAGGGAAAUCUAACA---GUGACUG------GGCCCGU--CGGCGACUUGUUCGCGUGAUCGCCGGGGCC----GAGAAAAU-CACA---GCGAACUccccg-gcuga-----------------------cagcgcgggcg-----agcacggcgcgccg-gguggcgggaugaccgc-acuccccacgc Ssc1t1
Sco5t1      GGGGAUG------AUCGGU--UUCGACAGCGGAUGUC-----GAAGCAGGGGAAGCGUGU--CGAGGAAGCGGCCAUGAUCUCGUAAACCAC-------AGGCCGA----AAACAAUAAUCGCCAACACCAAGCGC---------------------------------------GAUUCCUCCUCG------UUCGCCCUCGCUGCCUAA---------------UUAGCAGCUAGCGA--------ACUCUCAUAGGAG----------UGUCAGCCCGGGGCU------------------GUUCCCGACCCGGAUCCUGGCAUCGACUA---------------------------------------------------------GGGGACUAA---ACCUUGAUCCC--------------GGUCACGGGGUGAAGAGGGAAACCAAACA---GUGACUG------AGCCCGU--CGGAGACUUGUCCGCGUGAUCUCCGGGGCC----GAGAAAAG-CGAA---GCGGACUGCACA-CGGAG-----------------------AAGCCCUCCUU-----CCGCACCGUUGGAC-GCGGGUUCGAUUCCCGC-CAUCUCCACCA Sco5t1
Sav2t3      GGGGAUG------AUCGGU--UUCGACAGCGGCUGUU-----GAAGCAGGGGAAGCGUGU--CGAGGAAGCGGCAAUGAUCUCGUAAACCAU-------AUGUCGC----AAAAAAUAAUCGCCAAUACCAAGAGC---------------------------------------------GAUUCCCAGUCCUUCGCCCUCGCUGCCUAA-------------------UAAGCAGUGAGUGAGGGACCCUUAAUGGG------------UGUCAGCCCGGGAGU------------------GUUCCCGACCCGGACCCUGGCAUAAUCUA---------------------------------------------------------GGGGACUAA---ACCAUCGAGCCC-------------GGUCACGGGGUUCGAUGGGAAAUCAAACA---GUGACUG------GGCCCGU--CGGCGACUUGUUCGCGUGAUCGCCGGGGCC----GAGAAAAU-CGCA---GCGAACUGCACA-CGGAG-----------------------AAGCCCUGAUU-----CUGCACCGGUGGAC-GCGGGUUCGAUUCCCGC-CAUCUCCACga Sav2t3
Tfu1t1      GGGGGUG------AUCGGU--UUCGACUUCGAUGGUU-----GUUGUAGGGGAAGCGGGC--CGAGGAGAGCGGACGCAGCCUCGUUAAAAA-------UGCGACCGC-GAAAAAAUAAGUGCCAACUCUAAGCGC---------------------------------------------------ACUGAGUUCGCUCUCGCUGCUUGA------------------------UCGAG-AGUGACUC----------------------UGUCGGCCUGGGAGC------------------GUCUCCGACCCAGUGUCCGGCAUCGUUGA---------------------------------------------------------GGAGACUU----GCCGGUCAGAUCA------------GGCCACAGGAUCUGACUGGGACAUGCUC---UGUGGCUG------GGCCUGU--CGGCGACUUGUCUGCGUGAGCGCCGGGGCC----GAGGAGAACGCUGA--GCAGACUGCGCC-CGGAG-----------------------AAGCCCUGCUG-----CAGCAUCGAAGGAC-GCGGGUUCGAUUCCCGC-CACCUCCACgc Tfu1t1
Kra1t1      GGGGAUG------ACAGGU--UUCGACGUUGGUCGUC-----GAGCCAGGGGAAGCGGGU--CGAGG-AUGCAUGGUCAUCUCG----UCAACGA----UCCAUGCA---AACCAAUAGGUGCCGAUUCCAAGCGC---------------------------------------------------ACCGAGUUCGCCCUCGCCGCCUGA------------------------GCGAG-CGCGACUC----------------------UGUCAGCCCGGGUGA------------------GCUCCCGCCCCGGGUCCUGGCAUCGACUA---------------------------------------------------------GGGGGCUC----ACCUCUCACCGAG------------GUCGCGUAGGUGAG-AGGGACAAUCA----ACGCGGCUG------GGCCCGG--CGAUGACAUGCCUGUAUGAGCAUCGGGGCC----GAGCAGACCGCUGA--ACAGGAUGCACC-CGGAG-----------------------AAGCCCUGGUA-----CCACGCUGACGGAC-GCGGGUUCGAUUCCCGC-CAUCUCCACuc Kra1t1
Fcc1t1      GGGGGUG------ACCGGC--UUCGACUCCGGACGUC-----GAGGCAGGGGAAGCGGGC--CGAGG-AUGAGCGGUUAUCUCG----UUAACGA----UCCGUUCA------GAACAACAGCUGCCAACAAGACG---------------------------------------CAGCCCACUACCCCCACUUACGCGCUCGCCGCUUAA------------------------GAGGG--ACUAGGUAGU-------------------CGUCAGCCUGGGAGA------------------GCCUCCGGCCCAGAAUCUGACGUCG-CUA---------------------------------------------------------GGAGGAUC----ACCGGCUGACCUG------------GUCGCGGGGUCGGU-CGGGACAUCAAA---CAGCGACUG------AGCCUAU---GUCGGCUUGCCUGCGUGUCCGACGAGGCU----GAGAAACA-AGUA---GCAGGAUGCGCC-CGGAG-----------------------AAGCCCUGUGU-----CGGGGCCGGAGGAC-GCGGGUUCGAUUCCCGC-CACCUCCACaa Fcc1t1
Fea1t1      GGGGGUG------ACCGGC--UUCGACUCCGGACGUC-----GAGGCAGGGGAAGCGGGC--CGAGG-AUGAGCGGUUAUCUCG----UUAACGA----UCCGUUCA------GAACAACAGCUGCCACUAAGACG---------------------------------------CAGCCUGCUAGCUCCACUUUCGCCCUCGCGGCCUGA------------------------GUAGA-GACCAACUAGC-------------------CGUCAGCCUGGGAGU------------------UCCUCCGGCCCAGGAUCUGGCGUCG-ACA---------------------------------------------------------GGAGGAUC----ACCGUCCCACCCG------------GUCGCGGGGUAGGU-CGGGAAAUCUAA---CAGCGACUG------AGCCUGC---GCCGGCUUGCCUGCGGGACCGGCGGGGCU----GAGAAAAA-ACAA---GCAGGCUGCGCC-CGGAG-----------------------AAGCCCUGUGU-----CGGGGCCGGAGGAC-GCGGGUUCGAUUCCCGC-CACCUCCACCA Fea1t1
Blo4t2      GGGGGCG------AUCGGU--UUCGACGGUGACCUGU----UCGCUGCAGGGAAGCGUGC--CGAGA-ACGCCGGGUCCGCUCG---UGGAU-------GACCCCGGCA-AAAGAAUAAGUGCUAAAUCUAACCGC---------------------------------------------------ACUGAGUUCGCUCUCGCUGCCUGA-------------------UUUUUAGUCAGGAUUAACCAGUGAGCAGC------------CGCUCCGUUCACUCCUCCUC-------------GUCUUUGGGAGGAUGCUGAGCGUCGUUU---------------------------------------------------------AGAAGACUU----GCUGAUGCAGUUGA-----------GCCUCAGGGCUGCAUCGGGACUUUAA----CUGCGGAUA-------UGCUCGCCAUCAGUUGUCUGCGACAUCGAUGGGGGCAGAAAAAUCGCCAACUUGGCCAGCAGACUACGCA-CGUAG-----------------------AAGACUGUGGG-----UUCGGUCAUCGGAC-CGGGGUUCAAUUCCCCG-CGCCUCCACCA Blo4t2
Blo16t23    GGGGGCG------AUCGGU--UUCGACGGUGACCUGU----UCGCUGCAGGGAAGCGUGC--CGAGA-ACGCCGGGUCCGCUCG---UGGAU-------GACCCCGGCA-AAAGAAUAAGUGCUAAAUCUAACCGC---------------------------------------------------ACUGAGUUCGCUCUCGCUGCCUGA-------------------UUUUUAGUCAGGAUUAACCAGUGAGCAGC------------CGCUCCGUUCACUCCUCCUC-------------GUCUUUGGGAGGAUGCUGAGCGUCGUUU---------------------------------------------------------AGAAGACUU----GCUGAUGCAGUUGA-----------GCCUCAGGGCUGCAUCGGGACUUUAA----CUGCGGAUA-------UGCUCGCCAUCAGUUGUCUGCGACAUCGAUGGGGGCAGAAAAAUCGCCAACUUGGCCAGCAGACUACGCA-CGUAG-----------------------AAGACUGUGGG-----CUCGGUCAUCGGAC-CGGGGUUCAAUUCCCCG-CGCCUCCACCA Blo16t23
Rxy1t1      GGGGGCG-----AUCCGGC--UUCGACGGGAGCGGAC----AGCGUCCGGUGAGACGAGC--CGAGU-UCGCCGGAG--ACUCG---UAAAA-------CGCCGGCACC-UAAACAUACACGCCAACGACAGAGAG---------------------------------------------------------AUGGCGCUGGCUGCCUAA---------------------AACCACUGGCAGCC-------------------------CGUCGGUCCGGGCG-------------------GCCCACGGCCCGGUUUCCGGCGUCGGUU---------------------------------------------------------AGUGGGCUU----ACCUCCCGGGCUCC-----------GGCCCGGGGUCCGGGGGGGACACCACAG--CAGGGCUAG------CCCCUCUGCG------GCGCCCCGGUC--CGCAGAGGCC----GGUGAAGCUAAA--CCGGGUGCGACGCU-CGUAC-----------------------AAUCUCCCGGA---UGGCGCGCUCGCGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACug Rxy1t1
CYANOBACTERIA/PLASTIDS
CYANOBACTERIA: Gloeobacteria
Gvi1t1      GGGGAUG-----UACUGGC--UUCGACAGGGCAAUUAGAGCGUAACUGAAGCC-----------------UGCUC----GGUUA----------------GAGCAAA-----AAACCAAGUGCUACUAACAACGUA---------------------------------------------GUUCCCUUCGCUCGCGCC--CGCGCUACUGUCGCG---GCCUGAGUAA------------------------------------------GGCGGGGUUG-------------------------GUAGA-UAACCUUGUAAACC--------------------------------------------------------------AAAACUACCCAA-AAGGCCCCUUCG--------------------------GGGGCCUU-----------------UUUGCU*******************************************************************************************************ACUAGGGUGCGUGAUCGGCUGUUCUGGAC-AGGGGUUCGAUUCCCCU-CAUCUCCACCA Gvi1t1
CYANOBACTERIA: Prochlorales
Pma17t1     GGGGUUG-----UAAUGGU--UUCGACGGGGCGUAAGGAAGAUGACUGAAGCC-----------------UGCUC----GGUUA----------------GAGCAAA-----AACACAAACGCUAACAAAAUCGUU---------------------------------------------AGUUUCUCCCGUCAAACA-----GCACCAGUUGCU---GCUUGAUCUCAAA---------------------------------------GGAGAUGGGGUGA----------------------UAUCA-GCCUUAUCAACC----------------------------------------------------------------AAA-UGAUCCAA--GGAGCCUGGAA--------------------------GGGCUCC------------------ACCAUU*******************************************************************************************************ACUAGGUGAUCUCAACCGAUGUUUCGGAC-AGCGGUUCGAUUCCGCU-CAACUCCAuuu Pma17t1
Pma12t2     GGGGCUG-----CAAUGGU--UUCGACGGGGUAUGAGGAGGGUGACUGAAGCC-----------------UGCUC----GGUAA----------------GAGCAAA-----UCCGUAACUGCGAACAACAUCGUU---------------------------------------------CGUUUCUCCCGUCAGCCU-----GCCCUCGUGGCU---GCCUGACCCUAAUAAG------------------------------------GGAGAUGGGGUGA----------------------GGUCA-GCCUUAUCACCC----------------------------------------------------------------AAA-UGACCCAU--GGGGGCUGCGA--------------------------GGCCCCU------------------UUAACU*******************************************************************************************************ACUAGGUGAUCCACACCAGUGUCUCGGAC-AGCGGUUCGAUUCCGCU-CAGCUCCAuuc Pma12t2
Pma16t1     GGGGCUG-----CAAUGGC--UUCGACGGGGUUCUAGGAGUUUGACUGAAACC-----------------UGCUC----GGUUA----------------GAGCAAA-----ACCAUAACUGCUAACAAAAUCGUU---------------------------------------------AGUUUCUCCCGUCAAACA-----GCACCUGUUGCU---GCUUGACC-UUAUAAA------------------------------------GGAGAUGGGGUUA----------------------GAUCA-GCCUUAUCAACC----------------------------------------------------------------AAA-UGAUCCAU--UGGGCUUGGAA--------------------------GAGCCCU------------------UUUCAU*******************************************************************************************************ACUAGGUGAUUCACACCAUUAUCUCGGAC-AGCGGUUCGAUUCCGCU-CAGCUCCAucu Pma16t1
Pma15t1     GGGGCUG-----CAAUGGU--UUCGACGGGGUAUCAGGAGAGUGACUGAAGCC-----------------UGCUC----GGUCA----------------GAGCAAA-----ACCAUAACUGCUAACAACAUCGUU---------------------------------------------AGUUUCUCCCGUCAAACA-----GCCCCUGUUGCU---GCUUGAUC--UUUUA-------------------------------------GGAGAUGGGGUCA----------------------GGUCA-UCCUUAUUACCC----------------------------------------------------------------AAU-UGAUCCAU--GGAGCCUGGAA--------------------------GGGCUCC------------------UUUUUA*******************************************************************************************************ACUAGGUGAUUCACACCAGUAUCUCGGAC-AGCGGUUCGAUUCCGCU-CAGCUCCAuaa Pma15t1
CYANOBACTERIA: Chroococcales
Cgr1t2      GGGGCUG-----CAAUGGU--UUCGACGGGGCAUGAGGAGGGUGACUGAAGCC-----------------UGCUC----GGUCA----------------GAGCGAA-----CCCGUAACAGCGAACAACAUCGUU---------------------------------------------CGUUUCUCCCGUCAAGCC-----GCCCCCGUGGCU---GCCUGACACUCUUAAC------------------------------------GGAGACGGGGUGA----------------------GGUCA-GCCUUGUCACCC----------------------------------------------------------------AAA-UGACCCAU--GGGGCCUGGAA--------------------------GGGCCCU------------------UCCCAU*******************************************************************************************************ACUAGGUGGUCCACACCAGUGUCUCGGAC-AGCGGUUCGAUUCCGCU-CAGCUCCAuuc Cgr1t2
Scc1t1      GGGGCUG-----CAAUGGU--UUCGACGGGGCAUAAGGAGGGUGACUGAAGCC-----------------UGCUC----GGUAA----------------GAGCAAA----UCCCGUAACUGCGAACAACAUCGUA---------------------------------------------CGUUUCUCCCGUCAAGCA-----GCCCCUGUUGCU---GCCUGACC-CUAUUAA------------------------------------GGGAGAUGGGGUGA---------------------AGUCA-GCCUUAUCACCC----------------------------------------------------------------AAG-UGACUCGU---GGGGGUGGAAU-------------------------GCCCCC------------------UUAAAUC*******************************************************************************************************ACUAGGUGGUCCACACCGGUGUUUCGGAC-AGCGGUUCGAUUCCGCU-CAGCUCCAuuc Scc1t1
Scc3t1      GGGGCUG-----CAAUGGU--UUCGACGGGACAUAAGGAGGGUGACUGAAGCC-----------------UGCUC----GGUUA----------------GAGCAAA----UCUCGUAACUGCGAACAACAUCGUA---------------------------------------------CGUUUCUCCCGUCAAGCA-----GCCCCUGUUGCU---GCCUGACC-CUUUUAA------------------------------------GGGAGAUGGGGUGA---------------------AGUCA-GCCUUAUCACCC----------------------------------------------------------------AAA-UGACUGCUU--GGGGGUGGAA--------------------------GCCCCC------------------CUUCAAC*******************************************************************************************************ACUAGGUGAUUCACACCAGUGUUUCGGAC-AGCGGUUCGAUUCCGCU-CAGCUCCAuuc Scc3t1
Cpc3t1      GGGGCUG-----CAAUGGU--UUCGACGGGGCAUGAGGAGGGUGACUGAAGCC-----------------UGCUC----GGUAA----------------GAGCGAA-----CCCGUAACAGCGAACAACAUCGUU---------------------------------------------CGUUUCUCCCGUCAAGCC-----GCCCCCGUGGCU---GCCUGACACUCUUAAC------------------------------------GGAGACGGGGUGA----------------------GGUCA-GCCUUGUCACCC----------------------------------------------------------------AAA-UGACCCAU--GGGGNNNNNNN--------------------------NNNNNNN------------------NNNNNN*******************************************************************************************************NNNNNNNNNNNNNNNNNNGUGUUUCGGAC-AGCGGUUCGAUUCCGCU-CAGCUCCAuuc Cpc3t1
Cpc2t1      GGGGCUG-----CAAUGGU--UUCGACGGGGCAUGAGGAGGGUGACUGAAGCC-----------------UGCUC----GGUCA----------------GAGCGAA-----CCCGUAACAGCGAACAACAUCGUU---------------------------------------------CGUUUCUCCCGUCAAGCC-----GCCCCUGUGGCU---GCCUGACACUCUUAAC------------------------------------GGAGACGGGGUGA----------------------GGUCA-GCCUUGUCACCC----------------------------------------------------------------AAA-UGACCCAU--GGGGNNNNNNN--------------------------NNNNNNN------------------NNNNNN*******************************************************************************************************NNNNNNNNNNNNNNNNNNGUGUCUCGGAC-AGCGGUUCGAUUCCGCU-CAGCUCCAuuc Cpc2t1
Scc2t1      GGGGCUG-----CAAUGGU--UUCGACGGGGCAUGAGGAGGGUGACUGAAGCC-----------------UGCUC----GGUGA----------------GAGCAAA-----CCCGUAACUGCGAACAACAUCGUU---------------------------------------------CGUUUCUCCCGUCAAGCA-----GCCCCUGUUGCU---GCCUGACC--CUUUAA------------------------------------GGGAGAUGGGGUGA---------------------GGUCA-GCCUUAUCACCC----------------------------------------------------------------AAA-UGACUCAU--GGGGGCUGGAA--------------------------GGCCCCC------------------UCAACU*******************************************************************************************************ACUAGGUGAUCCACACCAGUGUUUCGGAC-AGCGGUUCGAUUCCGCU-CAGCUCCAuuc Scc2t1
Swh2t1      GGGGCUG-----CAAUGGU--UUCGACGGGGCAUGAGGAGGGUGACUGAAGCC-----------------UGCUC----GGUGA----------------GAGCAAA-----CCCGUAACUGCGAACAACAUCGUU---------------------------------------------CGUUUCUCCCGUCACGCA-----GCCCCUGUUGCU---GCCUGACC--CUUAGG------------------------------------GGAGAUGGGGUGA----------------------AGUCA-GCCUUAUCACCC----------------------------------------------------------------AAA-UGACUCAU--GGGGGCUGGAA--------------------------GGCCCCU------------------CAAACC*******************************************************************************************************ACUAGGUGAUCCACACCAGUGUUUCGGAC-AGCGGUUCGAUUCCGCU-CAGCUCCAuuc Swh2t1
Sel2t3      GGGGCUG-----UAAUGGU--UUCGACGUGUUGGUGAA--UCCUUCACCGUGAUUCAGGC--CGAGAG-GGAGUCCA-CUCUCGUAAAU-CC-------AGGCUCAA--CCAAAAGUAACUGCGAACAACAUCGUU---------------------------------------------CCUUUCGCUCGUAAGGCU-----GCUCCUGUAGCU---GCUUAAAC----------------GCCACAAACUUUCUGGCUCGAGC-----GUCUAGUCGUAGAC--------------------UCCGUUAAUACGCCUAGAC---------------------------------------------------------UUAAACCCCC-AACGGAUGCUCGAGU-GGCGGC-------------CUCAGGU-CCGUCCUCUCGCU-AAGCAA-AAACCUGAGC----------------AUC-CCGCCAACGGGGAU--AAUCGUUGGCUCCCGCACAGUGGGUC-AACCGUGCUAAGCC-UGUGA----------------------ACGAGCGGAAAGUU-ACUAGUCAAUGCGGAC-AGCGGUUCGAUUCCGCU-CAGCUCCAuuu Sel2t3
Spc2t1      GGGGCCG-----CAACGGU--UUCGACAGGUUGGCGAA-AGCUUCCACUGUGAUGCAGGU--CGAGAG-UGGGUCUC-CUCUCGCAAAU-CA-------AAGAUCCAAACAAAAUGUAACUGCGAACAACAUCGUU---------------------------------------------CCUUUCGCUCGCAAAGCU-----GC---UGCUGUA---GCUUAAUAAGAAC-----------ACCUUAA---CUUAGGUUCGAGC-----AUUCAUAAUUCGAC--------------------UCCGUUAAGGAUUAUGA-----------------------------------------------------------CUAAACCCCC-AACGGAUGCUCUCUAGGAAUAC-------------AUCUGGUU-UGCACUAGAGCU-AAGACU-AGACCAGAGA----------------UUCUUGG-CGACUCGGAACAAGCAGUC-GUUCCCGUUCUGAGGAUU-AGAAGAACUAAACC-UGUGA----------------------AUGAGCUAGGGGUG-AAUACCCAGUUUGGAC-AGCAGUUCGACUCUGCU-CGGCUCCAuuu Spc2t1
Spc4t7      GGGGCCG-----CAAUGGU--UUCGACAGGUUGGCGAA--AGCUUGCCCGUGAUACAGGU--CGAGAG-UGAGUCUC-CUCUCGCAAAUCAA-------AGGCUCAA--AAAAAAGUAACUGCGAAUAACAUCGUC---------------------------------------------AGCUUCAAACGGGUAGCCAUAGCAGCCUAGUCUGUAAAAGCUACAUUU--------------UCUUGU-----CAAAGACCGUUU-----ACUUCUUUUCUGAC--------------------UCCGUUAAGGAUUAGAGGU------------------------------------------------------------UAACCCC-AACGGAUGCUUUGUUUGGCUCUU------------CUCUAGUU-AGCUAAACAAUC-AAGACUCAGACUAGAGC----------------AUC-CCACCAUCAGGGAU--AAUCGAUGGUCCCCGUCCU-AGGGCU-AGAAGGACUAAACC-UGUGA----------------------AUGAGCGGAAAGUU-AAUACCCAGUUUGGAC-AGCAGUUCAAUUCUGCU-CGGCUCCAuuu Spc4t7
Cwa1t1      GGGGCCG-----CAACGGC--UUCGACAGGCUGGCGAA--AUCCAAAUUGUGAUUCAGGU--CGAGAG-UGAGUCUC-CUCUCGUAAAUACA-------AGACUCAA-AACAAUAGUAACUGCGAACAACAUCGUA---------------------------------------------AGCUUCAAGCGCGUAGCA-----------GUAGCU---GCGUAGAA----------------CUCUCU----CAUAGAGUCGCUU-----ACCUCUGACCUGAC--------------------UCCGUUAAGGACUCGGAGGU---------------------------------------------------------ACCAACCCC-AACGGAUGCCCUUAAUAGCUAC-------------CUCUGGUUG-GCUGUUGAGCU-AAGACU-ACACCAGAGC----------------AUC-CCACCGUUCGGGAG--AAUGAGCGGUUCCCGUCUG-AGGGUC-AGAAAGACUAAGCC-UGUGA----------------------AUGAGCGGUAGGUC-AAUACCCAGUCUGGAC-AGCAGUUCGACUCUGCU-CGGCUCCAuuc Cwa1t1
Tel1t1      GGGGCUG-----AAACGGC--UUCGACGUCCUAGUGAA--AGUUGGGCUGUGAUGCAGGU--CGAGAG-UGGACUAU-CUCUCGUUAAUCCA-------GAGUCCAA-GCCAAAAGUAACUGCGAACAACAUCGUU---------------------------------------------CCUUUCGCUCGUAAAGCUGC------UGCG-----GUAGCCUAAG-----------------ACCUCUA---AACAGGUUCGAGC-----ACUCGUUGUCCGAC--------------------UCCGUUAAGGGCAGCGGGU------------------------------------------------------------UAACCCC-AACGGAUGCGCUAGACAGUUCU-------------CUCUGGU-GGGCUGUUUAGCA-AAGACU-CGACCAGAGC----------------AUC-CUACUGUUCGGGAU--AAGGAACAGUCCCCGCCUG-AGGGUC-AAAAAGGCUAAGCC-UGUGA----------------------AAGAGCAGUCGAUG-AAUAGCUAGGGCGGAC-ACGGGUUCGACUCCCGU-CAGCUCCAuua Tel1t1
CYANOBACTERIA: Pleurocapsales
Cpc1t1      NNNNNNN-----NNNNNNN--NNNNNNAGGUUGGCGAA--AGCUAAUCUGUGAUGCAGGU--CGAGAG-UGAGUCGC-CUCUCGGAAAU-AC-------AGGCUCAAAUCUAAAUAUAGAUGCAAACAACAUCGUA---------------------------------------------AAAUUCGAGCGUCAAGCA-----------GUAUUU---GCUUAA------------------GCCCAA----CUGAGGCUUGCUC-----GCUUUUAGUCCGAC--------------------UCCGUUAACGGCUAAAACG------------------------------------------------------------AAACCCC-AACGGAUGCACCUUUUAGUUAC-------------UUUCGGU-UGACUAAUUGCGUAAAGACU-UCACCGAAAC----------------AUC-CUACUAUCAGGGAU--AAUUGAUAGUUCCAGUUCUUGGGAUU-AUAAGAACUAAACC-UGUGA----------------------AUGAGCAGAAUGUC-AUUAUCCAGUCUGGAC-AGCANNNNNNNNNNNNN-NNNNNNNNNNN Cpc1t1
CYANOBACTERIA: Oscillatoriales
Oac1t2      NNNNNNN-----NNNNNNN--NNNNNNAGUGGAGUGAA--AGCUGCUCCGUGAUUCAGGC--CGAGAG-UGAGUUGU-CUCUCGUCAAUCCC-------CAACUCAA-AAAAAAAGUAAAUGCGAACAACAUCGUU---------------------------------------------CCUUUCGCUCGUAAAGCG-----GCUCCUGUAGCU---GCCUAAAA----------------ACCUCU----AGCAGGUUUGAGCG----GUCUAUAGCUUGAC--------------------UCCGUUAAAGGCUACAGAC-----------------------------------------------------------AAACCCUC-AACGGAUGCUCUAGUAAGGUUU-------------CUCUGGUU--ACUUGCUAGUU-AAGACU-CAACCUGAGU----------------AUC-CUGUCAUCCGGGAU--AAUGGAUGGUCCCCGCCCAGAGGGUU-AAAUGGGCUACGCC-UGUGA----------------------AUGAGCGGUAGGCG-AAUACCUCUGCUACAC-AGCANNNNNNNNNNNNN-NNNNNNNNNNN Oac1t2
Osa4t1      NNNNNNN-----NNNNNNN--NNNNNNAGGGUGGUGAA--AUCUGCUUUGUGAUGCAGGU--CGAGAG-UGAGUCUU-CUCUCGCAAAUACC-------GGGCUCAA--CAAAUAAUAAGUGCAAACAACAUUGUA---------------------------------------------CCUUUUGCUCGUAAGCAA-----GUAGCUGUAGCUUAAUUGCCGAAAC--------------GCCUCU----UAUAGGUUCGAGC-----GUCUGUGAUUUGAC--------------------UCCGUUAAGGAUUGCAGAC-----------------------------------------------------------UUAACCCC-AACGGAUGCACUAGCUCACUGC-------------CUCUGGU-CGGCU-GCUGGUU-AAGACU-UCACCGGAGA----------------AUC-CCGCCAUCUGGGAU--AAUGGAUGGUCCCCGCCUUCAGGGUUAAGAUAGGCUAAACC-UGUGA----------------------AUGAUCGAAGAGUG-AAUAGCCACUUUGGAC-ACGGNNNNNNNNNNNNN-NNNNNNNNNNN Osa4t1
Ter1t1      GGGGCAU-----UAACGGU--UUCGACAGGGUGGUGAA--AUCUGCUUUGUGAUGCAGGC--CGAGAG-UGAGUCUU-CUCUCGAAAAUCCU-------GGACUCAA--AAAAUAAUAAGUGCAAACAACAUUGUA---------------------------------------------CCUUUUGCUCGUAAGCAA-----GUAGCUGCUCUA---GCUUAAUUGCAAAAAC--------ACCUCU----UAUAGGUUCGAGC-----GUCUGUGGUUUGAC--------------------UCCGUUAAUAAUUGCAGAC-----------------------------------------------------------UUAACCCC-AACGGAUGCUCUAGCAAUUUUU-------------CUCUGGUUA--CCUGCUAGUU-AAGAUU-UAACCAGAGC----------------AUC-CCACUAUCCGGGAU--AAUGGAUAGUCCCAGCUCUGAGGGUUAAGAAGGGCUAAACC-UGUGA----------------------AUGAGUGAAGGGUG-AAUAGCCAUUUUGGAC-AUGGGUUCGACUCCCAU-AUGCUCCAuac Ter1t1
Lbo1t3      NNNNNNN-----NNNNNNN--NNNNNNAGGUUGGCGAA--CGUUCCAUCGAGAUGCAGGU--CGAGAG-GGAGUCCA-CUCUCGUAAAU-CU-------AGGCUCAA----AAAAAUAGAUGCAAACAACAUCGUA---------------------------------------------CCUUUCGCUCGUAAAACU-----GCACCUGUUGCA---GCAUAAAAC---------------ACCUCUAA--UUCAGGUUCGAGC-----GCUUACCGUCUGAC--------------------ACCGUUAAAGAUAGUAAGC-----------------------------------------------------------ACAACCCC-AACGGUUGCUCUAGAAUUUCGC-------------CUUUGGU-CGGCAUUCUAGCU-AAGACA-AUACCAAAGC----------------AUC-CUAUUGUCCGGGAC--AAAGGACAGUUCCCGCUUCGAGGAUU-AGAGAAGCUAAACC-UGUGA----------------------AUGAUUGAUAGAGCUAAUACCCAGUUUGGAC-ACGGNNNNNNNNNNNNN-NNNNNNNNNNN Lbo1t3
CYANOBACTERIA: Nostocales
Npc1t2      GGGUCCG-----UAACGGU--UUCGACAGGUUGGCGAA--CGCUACUCUGUGAUUCAGGU--CGAGAG-UGAGUCUC-CUCUCGCAAAU-CA-------AGGCUCAA-AACAAAAGUAAAUGCGAAUAACAUCGUU---------------------------------------------AAAUUUGCUCGUAAGGAC-----GCUCUAGUAGCU---GCCUAAAUA---------------GCCUCU----UUCAGGUUCGAGC-----GUCUUCGGUUUGAC--------------------UCCGUUAAGGACUGAAGAC------------------------------------------------------------CAACCCCCAACGGAUGCUCUAGCAAGUGUU-------------CUCUGGUU-GGCUUGCUAGCU-AAGAUU-UAAUCAGAGC----------------AUC-CUA-CGUUCGGGAU--AAUGAACGAUUCCCGCCUUGAGGGUC-AGAAAGGCUAAACC-UGUGA----------------------AUGAGCGGGGGGUC-AAUACCCAAUUUGGAC-AGCAGUUCGACUCUGCU-CGGAUCCACua Npc1t2
Npu1t1      GGGUCCG-----UCACGGU--UUCGACAGGUUGGCGAA--CGCUGCUCUGUGAUUCAGGU--CGAGAG-UGAGUCUC-CUCUCGGAAAUCAA-------AGGCUCAA-ACAAAAAGUAAAUGCGAAUAACAUCGUU---------------------------------------------AACUUUGCUCGUAAGGAU-----GCUCUAGUAGCU---GCCUAAAC----------------ACCUCU----UAUAGGUUCGAGC-----GUCUUUAGUUUGAC--------------------UCCGUUAAGGACUGAAGAC-----------------------------------------------------------CAAACCCC-AACGGAUGCUCUAGUAAGCGUU-------------CUCUGGUU-GGCUUGCUAGCU-AAGAUU-AAAUCAGAGA----------------AUC-CUA-CGUUCGGGAU--AAUGAACGAUUCCCGCCUUGAGGGUC-AGAAAGGCUAAACC-UGUGA----------------------AUGAGCGGGGGGUC-AAUACCCAAUUUGGAC-AGCAGUUCGACUCUGCU-CGGAUCCACua Npu1t1
Ava1t1      GGGUCCG-----UAACGGU--UUCGACAGGUUGGCGAA--CGCUACUCUGUGAUUCAGGU--CGAGAG-UGAGUCUC-CUCUCGCAAAU-CA-------AGGCUCAA-AACAAAAGUAAAUGCGAAUAACAUCGUA---------------------------------------------AAAUUUGCUCGUAAGGAC-----GCUCUAGUAGCU---GCCUAAUUA---------------GCCUCU----UACAGGUUCGAGC-----GUCUUCGGUUUGAC--------------------UCCGUUAAGGACUGAAGAC------------------------------------------------------------CAACCCCCAACGGAUGCUCUAGCAAGUGUU-------------CUCUGGUU-GGCUUGCUAGCU-AAGAUU-UAAUCAGAGC----------------AUC-CUA-CGUUCGGGAU--AAUGAACGAUUCCCGCCUUGAGGGUC-AGAAAGGCUAAACC-UGUGA----------------------AUGAGCGGGGGGUC-AAUACCCAAUUUGGAC-AGCAGUUCGACUCUGCU-CGGAUCCACua Ava1t1
Fdi1t1      NNNNNNN-----NNNNNNN--NNNNNNAGGUUGGCGAA--CGCUGCUCUGUGAUUCAGGU--CGAGAG-UGAGUCUC-CUCUCGCAAAUCCA-------AGGCUCAA-AACAAAAGUAAAUGCGAACAAUAUCGUA---------------------------------------------AAAUUUGCUCGUAAGGAA-----GCCCUAGUUGCU---GCCUAAUA----------------GCCUCU----UAUAGGUCCGAGC-----GUCUUUAGUCCGAC--------------------UCCGUUAAGGGCUAGAGAC------------------------------------------------------------CAACCCC-AACGGAUGCUCUAGCAAGUAUU-------------CUCUGGUU-GACUUGCUAGCU-AAGACU-UAAUCAGAGC----------------AUC-CUA-CGUUCGGGAU--AAUGAACGAUUCCCGCCUUGAGGGUC-AGAUAGGCUAAACC-UGUGA----------------------AUGAGCGGAGGGUC-AAUACCCAAUUUGGAC-AGCANNNNNNNNNNNNN-NNNNNNNNNNN Fdi1t1
PLASTIDS: Viridiplantae
Mvi1t3      GGGGUUG-----AAAUGGU--UUCGACGUUUUAGUAU-AUAUC--UUCUUACAAGCAAGU--CGAGA-AUGAACCAA--UCUCGUAAAC--------UUGAGUUCA--AUUGCAAAUAAAUGCUAACAAUAUUUUA------------------------------------------CCUUUUAAUCGUAAGACAGCCGUAGCUGUUUAAAAGUUUUUUGAUAACUUCGAGCAUUUUUGAUUUGUUAAAUACAAUUGUUA--UAAAACAAAUUAAAUAAUAGUU----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUUGUUUCUUUACAAAUAAUGUAGAAAUAAUUUUUUUUAGCUUUUCAAGCUCCAGCUUUGUGGAUUAGCAAAGCUAAACU-UGUGAAUA-----------------------CAAAGAAGAGAUCAAACUAAAGCGGAC-GCGGGUUCAAAACCCGC-CAGCUCCAuaa Mvi1t3
Nol1t2      GGGGUUG-----UCAUGGA--AUCGACGUCUCUUCUA-AGAACGAAAGGUUAAAGCAGGU--CGAG-GUCGAAGAUGGA-CUCGUACUC--------UCCACUUCA-UUGCUUGAUUGCAUGCUAAUCAGAUUCUU------------------------------------------CCUUUCUCUCGCCGGGUAGCCGUUGCUGCUUAAGCGAGUUUCUAGUGCCACUUUGUCACUAGUUUGUAUUAUGAGUUUCACACUCACUUCAAUGACGGUGAUAGAUA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CUACAUAUCACUCCUGCUUAGAGGGUCAUCUAAGCUAAACCAUGUGAAUA-----------------------UAACCUUUCGGGCCUCGAGAGACGGAA-GUGAGUUCAAUUCUCAC-CAACUCCACCA Nol1t2
PLASTIDS: Glaucocystophyceae
Cpa3t1      GGGGCUG-----UUUAGGU--UUCGACGUUUUUUUCUAAUUAU--GUUUGUUAAGCAAGU--CGAGGAUUUGUUCUA--UCUCGAAAAUCA---------AGAAC-UCUCAAAAUUUAAACGCAACUAAUAUUGUA------------------------------------------CGUUUUAACCGUAAAGCAGCUUUCGCUGUUUAAUAAUUACUUUUAAUUUAAAAACCUAAUUUUUUUAGGAAUUUAUUUAUUUAUUGUUUAUCCUGCUUAAUGAAUUAAAAAAAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CUAUACU-UGUGA--------------------------AUAAACGCAUAAUUUAAAAAAACGGAC-GUGGGUUCAAAUCCCAC-CAGCUCCACuc Cpa3t1
PLASTIDS: stramenopiles
Aco2t1      NNNNNNN-----NNNNNNN--NNNNNNAUCUAAAAUUAAUUAC---UAUAUGAAUCAGGU--CGAAG--CUUGUACU--CUUCGAAAAAAU-------CUACAAAC---UAUAAUAUAAAGGCUACUAUUAUAACA------------------UGGUUUAUUUCAAAAAUUAUAAAUCGUAAUGCUUGUUCAUUACAAUUUGUAGUUUAA------------------------UUAACUUUAUUUCUACACAAACAAAUUAUUCACUAGAUCU-AU-CAUUUUUCAGAAUUUUAGUUUAGAAUAACAAUACUUUUU------UUUGUUC------UUUAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CUAUGCC-UGUGAACG----------------------AGUAUAUUAAAUC--AUUUUAGAUGGAC-AUGGNNNNNNNNNNNNN-NNNNNNNNNNN Aco2t1
Twe1t1      GGGGCUG-----AUUUGGU--UUCGACAUUUAAAACUUCUUUC-----UAUGUGUCAGGU--CAAAG--UUUGUAUU--CUUUGUAAAAAA-------AUACUAAA---AUACUAAUAAAUGCUAAUAAUAUAAUA------------CCGUUUAUUUUUAAAGCAGUAAAAACAAAAAAAGAAGCAAUGGCUUUAAAUUUUGCUGUAUAG------------------------UUCAUUAACUUAGGUUAUUAAAUAUUUUUUCAUUAUAACU-GGACUUUUCUCUAGUUUAUAGUUUAGAAUAAAUUUAAAUUUUGCAAAACUCGUUCGAAAAUUUUCGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CUAAACC-UGUAAACGCA--------------------AAUAC--UAAGAAA--UUUUAGAUGGAC-AUGGGUUCAAUUCCCAU-CAGUUCCAauc Twe1t1
Tps1t2      GGGGCUG-----AUUUGGU--UUCGACAUUUAAACACUAUUUC-----UAUAUGUCAGGU--CAAAG--UUUGUAUU--CUUUGUAAAAA--------AUACUAAA---UUAUUAAUAAAUGCUAACAAUAUAAUG------------CCUUUUAUGUUUAACGUAGUAAAAACAAACCGUUCAUUAACUACUUUAAAUUUCGCUGUUUAA------------------------UCACUUAACUUAGGUUAUUAAAUAUUUUUUCAUUAUUGCU-AGACUUUUAUCUAGUAUAUAGUUUAGAAUAAGUUUAAAUUUUAAAAA--UUGUUC-AAGUUUUUUGAACUAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACC-UGUAAAUGAG--------------------UAUAU--UAAUAAA--CUUUAGAUGGAC-AUGGGUUCAAUUCCCAU-CAGCUCCAaua Tps1t2
Osi1t1      GGGGCUG-----ACUUGGU--UUCGACAUUUAAAAAUUG---UUACAGUAUGAUGCAGGU--CGAAG--UUUCUAAU--CUUCGUAAAAAA-------AGAGAAA----UUUAUAAUAAAUGCUAAUAAUUUAAUU------------UCUUCUGUGUUUAAAAGUUUAUCAACUAAGCAAAAUAGUUUAAAUUUAAGUUUUGCUGUUUAAGUUUUAUGCACAUUUAAUGAUCUAGUAAAUAACUUUG-UUCGCUA-UAAUUUAUAUUUAUAACU-AGACUUUUGUCUUUUUUAUAGUUUAGAAUAACUUUAUCAUUU-CAAACCUCGUUC-----CAUC-UAGUUGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CUAAACC-UGUGAACG----------------------AAUACUAUAAUAAAAUUUUUAGAUGGAC-GUGGGUUCGACUCCCAU-CAGCUCCAuau Osi1t1
Sco1t1      NNNNNNN-----NNNNNNN--NNNNNNAUUUAAAAGUUAUUUA-----UAUAAGCCAGGU--CAAAG--UUUGUACU--CUUUGUAAAAA--------AGACUAAAUU-AUUAUAAUAAAUGCUAACAACAUAAUG------------UCUUUUAUUUUUAAAACAGUAACUCCAAAAAAUCAUUUAAAUGUUUUAAGUUUCGCUGUUUAA------------------------UUAUUUAAUGUAGUUUAUUAAAUAUUUUUUCAUUAUAGCU-AGACUUUUUUCUAGUAUAUAGUUUAGAAUAAAUUUAAAUUUU--AAAGAUUGUUC------AAAUCAUUUGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CUAAGCC-UGUAAACG----------------------CGUGU--AUAAAUAAGCUUUAGAUGGAC-AUGGNNNNNNNNNNNNN-NNNNNNNNNNN Sco1t1
Fpi1t1      NNNNNNN-----NNNNNNN--NNNNNNAUUUGAAAAUAACUAA---AGUAUGAUGCAGGU--CGAAG--CUUGUAUU--CUUCGUAAAAAU-------CUACAAA----UUUAACAUAACUGCUAAUAAUAUAAUU---------------CCUUUUCACUUUAAAACAGUAAAUUUCAAUAACUCAAAUUUAUUACAAUUUGCUGCUUAA----------------------AUAAAAACGAACUUUUAGUAACAAAAUUGGUACUCUAU-UCUGAGACGUUUC-GUUUUAGAUAGUUUUGAAUAAUUUUAACA---------GUUGUUC--------ACUUAUCGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CUAUGCC-UGUGAACG----------------------AAUAC--UUUAAUUAAAUUUAGAUGGAC-GUGGNNNNNNNNNNNNN-NNNNNNNNNNN Fpi1t1
Bol1t1      NNNNNNN-----NNNNNNN--NNNNNNAUUAUAAAAAUUUUAA---AUUAUGAUGCAAGU--CGAAA---AAUAUUA--UUUCGUUAAAA--------AAUAUACC---UUUAAAAUAAAUGCAAAUAACAUUUUA------------------------------------------GCUUUUAACCGUAAAUCUUUAAGUUUCGCUUAAAAUUAUUUAUGGAAAUUUUUAAGAGUGUCCAUCUCUUAAAAAUUUGAAAACUUUAUGGACAUUAUAAAACUAGACUUUUCUAGAUCUUUUAAGUUAAAUUAUUACUUAAUUCCUUUUAAUUUGUUCAUUUUAAAUGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CUAAACU-UGUGAACG----------------------AUUAAUUUAUCAC--UUUUAUAAUGGAC-GUGGNNNNNNNNNNNNN-NNNNNNNNNNN Bol1t1
Pli2t1      NNNNNNN-----NNNNNNN--NNNNNNAUUUAAAAUUAUAAU-------------AGUUA--CUAAG-CAGAUUUAAGUCUUAGAAUA------------UAAA-----------AUAAUUGCAAACAACAUUAUG---------------------------------------------AGCUUUAAUAAAAACCAAGUUUUUGCAUAAAAUACUUGAGUUUUAAUAUCAAUCAAUUUUAUAAUUGUUGAUUGAAAUAGGUAGAAGAUUAUUUUUUCUCUUAAAUUUUAGUUUUGGUAAUUUUACUAUCAGUAAAAUAUAAUAUUUAUAAAAUAAAUAUAAAUCGAU---------------------------------------------------------------------------------------------------------------------------------CCAUAUUUUUGCUACCAAUCUGUUUUUAAUAGUUUUAAGCUUAUUUUAGCUAAGCAGAUUGAUAA-CUAAAUCUGUGAUUU-----UAGUACUUAGUUUGAUAAUU------UUUUAAAUGGAC-GUGGNNNNNNNNNNNNN-NNNNNNNNNNN Pli2t1
PLASTIDS: Haptophyceae
Plu1t1      GGGGCUG-----UUUAGGU--UUCGAUCCUAAAAAAAACUAAUA--AGUGUGAUGCAAGU--AGAGG----AAAC----CCUCUUAAAAAA--------------AAAGCAAACAAUAAAUGCAAACAAUAUUUUA------------------------------------------------UCUUUUAAUCGAGUAGCUGUAGCCCCGUAUAGUUAUAUAGCAUUAACUCCUUAUGGUCAAAAAAUCUAGAAAGUUUGAUCGUAAAGCAAACCUUAGCUAGAAGCACACAAGAAUAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------NNNNNNNNNNNNNN-------------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN-NNNNNNNNNNNNNNNNN-NNNNNNNNNNN Plu1t1
Ppa4t1      NNNNNNN-----NNNNNNN--NNNNNNAUUUAGGUCUGGA----AGUUUUUAA--AAUAU--UCCU----AAUUUA----AGGAUAAUCUC----------------------AAAUAGUUGCAAAUAAUAUUUUA---------------------------------------------UCUUUUAAUACUAAACUAGCACUAGCUUAAGUUUUUAGUAUAAUCAGUUAUGGUAUUUUACUCUUUUAACCUUUCUGAUAAACAUAAAAAAGAGGCGCAUUUUUGCAAAGAAAUUUAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUAAAUG-UUUUCU-------------AUGGUUGUAAAUAAAGAACUUUUUUAGGGCUAAAUGGAC-GUGGNNNNNNNNNNNNN-NNNNNNNNNNN Ppa4t1
PLASTIDS: Rhodophyta
Cca3t1      GGGGCUG------AAAGGAUAUUCGACAUAUUAAUUUCGUGCG----CUAUGAUGCAAGC--CGAGA---AUGCUUA--UCUCGUAAAA-----------AAGCA-GACAAAGAAAUAAAUGCAAACAAUAUUAUU------------------------------------GAAAUUAGCAAUAUUAGAAAACCAGCUCUAGUAGUCUAGCCUGAUUCAGUUAUUUCUAAAUUAUUUAUGUUAUGUUAU----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUAAGCU-UGUAGU------------------------AACUAUCUAGUGUACAAUUUCUAUGGAC-GUGGGUUCAAUUCCCAC-CAGCUCCACaa Cca3t1
Cme3t10     GGGGCUG------UAAGGU-GUUCGACAUAAGUUGUU------------------GUUAU----------------------------------------------------UCAAUAAUUGCAAAUCAAAUUCUA---------------------------------------CCUUUUUCUAUUCCCGUUAAACAUCUAGCUGUUUAAAUUUAAAGACAAUUUAAAGACAAUCUAAAGACUCAAGAGACAAAAAUUUUAGGUAUUUAGGUAACUUUUAGGUAACUAAGUAAGGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UAAGUA-ACGAA---------------------------------------AACAACUUAUGGAC-GUGGGUUCAAUUCCCAC-CAGCUCCAaug Cme3t10
Rma1t1      NNNNNNN------NNNNNN--NNNNNNNNNNNNNNNNNNNNNN-NNNNNNNAAUACAAGU--CGAGAA-UGAGAAU--UUCUCGUUAAAAU---------UUCUCAAAAAAAAUAAUAAAUGCAAAUAACAUUUUA------------------------------------AAAUUCUUUACCAAGUCUCCGGUAGUAGCAUUCGCUUAAAACCUUUGGUUUCACAUUAGUCUAAUCUUAAUUUAAUAUGAAAAUCUUUAAGAUGCAGCUAAAAAAUAAAUUUAGCUAAGAACCCUACGCAAUCAAAUGUAUGUAUAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACU-UGGAAUAC------------------------UAUUGACUAAUACAAUCUAAUUGGAC-GAGGNNNNNNNNNNNNN-NNNNNNNNNNN Rma1t1
Ppu1t1      GGGGCUG------CAAGGU--UUCUACAUUGUGAAAAAACAAA-UAUAUGAAAGUAAAAC--GAGCUC-AUUAUUA--GAGCUUU---------------UAGU--------UAAAUAAAUGCAGAAAAUAAUAUU------------------------------------------AUUGCUUUUUCUCGAAAAUUAGCUGUUGCAUAAAUAGUCUCAA--------------UUUUU--GUAAUUC-GAAGUGAUAGACUCUUAUACACUAC-GAAUAUUC-UGUUAGAGUUGCUCUUAAUAAAAGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGUAAAAAAAUACAAAUUC-------UUAUGUU-UUUUACCUGAAUUG--AUU-CAAUUUAAGGUUAGUAUUUUUUGAUUUUUACAAUGGAC-GUGGGUUCAAGUCCCAC-CAGCUCCAuca Ppu1t1
Gte1t1      GGGACUG------CAAGGU--UUCUACAUAUAGU-----AUAC-AAUAUA---CAUUGUCAUUAAUA--UAACUU----UAUUAC---------------UAUUA----------GUAAAUGCUAAAAAUAAUAUA------------------------------------------UUAACUUUAUCUAGAAGAUUAAUUUAUGCUUAAACUUUUUGAAAUAAAAGAUUAAGCAGUUACAGAUUGUUACUAGAACUCAAAUAAUAUAAGCCAUAUAGUUAUUUGAUAUAUUGAAUUUGGUUGCUCUUAAAUUAGUCUUAAUCAAAGAAUUAAUUUUAAGAUAAGUAAGAAAUCAUUACA-------------------------------------------------------------------------------------------------------------ACAUCAAAUCGUAUUUUUUAGAUUACAUCUAUAAUAUAUUACUUAUAAUAUAUUAUUUCUAAUGUAAUUAGAC-GA----------------------------------UAUAUAGUAUAUUAUUAUGGAC-GUGGGUUCAAUUCCCAC-CAGUUCCAuac Gte1t1
Mpa1t1      NNNNNNN------NNNNNN--NNNNNNAUAUAGU-AUUGUAUG-UAUAAGUAGUAAAGGA--UGAAG-GUAAGCUAAA-CUUCAUUAAUCC---------UAGCUUG-----ACUACAAAUGCAAAACAUCAAAUU------------------------------------------GUUCCUUUUUCUAAAAGAAUUAUAGUAGUAUAAUAU---------------------UUUUUAGAAUAUUA-GAUUAUAAUUUCUC-UAAAUAAUCU-GGUAUUUU-UAUUUGAGAUGCUCUUAAUUAGAUAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CUUAUUUUUAAGCAAAGU--UACAAUUUUUAUAU-AUUUUUCC-UUUGUACUUGA----CUUG----UAUAAGUAUACUUUACAUACAGUUUUGAUAUGGAC-GUGGNNNNNNNNNNNNN-NNNNNNNNNNN Mpa1t1
Pla4t1      NNNNNNN------NNNNNN--NNNNNNAUAUAAUUC-CGUCUA-UAUAAGGUUCAGAGAA--UGAAG-GUGAGCUAAA-CUUCAAUAAUCC---------UAGCUUA-----AAAACAAUUGCAAAACAUCAAAUU------------------------------------------UUACCAUUAUCUAGGAAAAUUGCUUUAGCUUAAUAUAAGUAAAAGAAAAUAUGAUUUUUUCUAGGUUAUCAAGAUUGAGA-UUCUAGUAUAUAUCUUGAUUGGUUAUUACACUAGAUGCUCUUAAAUUUAUGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUUAAGCUAAGU--UUCAAUCUAUUUAUUGUUUUUUC-UCUUGACUUAGUCAAUAAUUUGAUAAUUGUCAACUUAUUAAGCUGAAUUACUAUGGAC-GUGGNNNNNNNNNNNNN-NNNNNNNNNNN Pla4t1
PLASTIDS: Cryptophyta
Gth4t1      GGGGCUG-----AUUUGGA--UUCGACAUAUAAAUUUGCGUGUUUCAUUAUGAAGCAAGU--CAAG---UUUAAUG--AUCUUGUAAAAAA---------CAUUAAA--GUACAAAUAAAUGCAAGCAAUAUAGUU---------------------------------------UCAUUUAGUUCAAAACGUUUAGUCUCUUUUGCAUAAGCAAAAUGUGUUAAUAACUUUCUUAGUAGAAAUUGGAGAAGUUUACUAAGAUUUAUAUUUACUCCAUAAUUAUUUUAAAGAUGGUAAAAAGGUGAUUCAUCAUUUGUAUGUUU--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CUAAACUUUGUGAAAG----------------------AAUAGUGGGCUCC-AUUUAUA-AUGAAC-GUGGGUUCAAAUCCCAC-CAGCUCCAuag Gth4t1
Rsa2t2      NNNNNNN-----NNNNNNN--NNNNNNAUUUUGGAAAGAAUAGUA--UUAUGAUGCAAGU--CAAGAU-UGAGCUC--AUCUUGUUAAUAA---------AGCUCAU---CAUAAAUAAAUGCAAAUAAUAUUGUA---------------------------------------------CCUUUUUCUCGUAAGGUCGCUUUAGUUUAAGAUUGUUUUCCUCAUUGGAGACUUGAUUAAUCUAUAAAAAUAAGUUAAAGCUAAAACAUUGGAAGAAAUUUAGCUUAUAAAUAAAAUUCCGUUCUCAUAACUUUAGUGGGUAAAAAAAUACUUUCUUUGAGUAUUGAACAAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AUAAACU-UGUGAAUG----------------------AGUGUGCUACGUAAG--CUGAAAUGGAC-GUGGNNNNNNNNNNNNN-NNNNNNNNNNN Rsa2t2
VIRUSES
Mph5t2      GGGCCUG-----ACAAGGU--UUCGACUGGUCGAUGG------ACAACUGAACAGCGGGC--GAGUGUUGGCCGCACUUCUACUC---UGAGU------GAACGCGGC--AACUGAUAAACGCAACCGACACGGAU------------GCAACGGUGACCGACGCCGAGAUCGAGGCCUUCUUUGCUGAAGAGGCUGCCGCUCUCGUCUGA-----------------AGGAACCAGCCUGGCUCAGCG----------------------UGCUGCUGUGCAGCGGCCAGGCUUCAUCUCUAACAGCAGCGAACG--------------------------------------------------------------------GACAUGAGGGAGCGCAAACCCUCGUCCCAAACAUCAUGAAUGCGUCGCACGGGCUCCAGCGUCAGGGGCCAGAGGUGGGAAA---------CGGUGUGAAACUCCUGUCCUGGGGAUCACCGACCG-----AUACGCCAAA-----CCAGGACUACGCC-CGUAG-----------------------AACGCAGUGAG-----AAAGACACCAGGAC-AGGGGUUCGAGUCCCCU-CAGGUCCACgu Mph5t2
Bph1t1      GGGAUUG-----UUAAGGA--UUCGACAGGGGAAAAU-----AGUAUAAGACAUGAUACU--CGUA----AAGCA-----UACG-------------------------------UUACAUGCUAAGUUAAAUAUA-----------------------------------------------ACUAACAACGAAUUACAAGUAGCCUAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUAAUAGGUGCCAAAACAAUAGAGUUGCUCUAACAUCUAUUUGAGGUUCAAAGAUUUGAGCUAUUUCUUACUUUAGAAUAAAGUAAGUGGUGGAGCCUAGAGAAAACGCUGUAGAAACUAACUAUUCAAAUUGUAAAUGGUAUCAAA-------------------------CAAGUGUCUAUAUGAAAGUCUUCUGGAC-GCGGGUUCGACUCCCGC-CAGUUCCAuau Bph1t1
AQUIFICAE
Aae2t2      GGGGGCG-----GAAAGGA--UUCGACGGGGACAGGCG-----GUCCCCGAGGAGCAGGC--CGGG----UGGCU-----CCCGUAAC------------AGCCG--------CUAAAACAGCUCCCGAAGCUGAA---------------------------------------------------------CUCGCUCUCGCUGCCUAAUUAAACGGCAGCG-----------------------------------------------CGUCCCCGGUAGGUUU-----------------GCGGGUGGCCUACCGGAGGGCG----------------------------------------------------------UCAGAGACACCCGCUC--GGGCUACUCGGUC------------GCACGGG-GCUGAGUAGCU-GACACCUAACCCGUGC-UA-------CCCUCGGGGA-GCUUGCCCGUGGGCGA-CCCGAGGG------GAAAUCCUGAA----CACGGGCUAAGCC-UGUAG-----------------------AGCCUCGGAUGU-GGCCGCCGUCCUCGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Aae2t2
Saz1t1      GGGGGCG-----AUACGGG--UUCGACGGCAAGAGCAG------GCAAAGGGAAGCAUGC--CGUAG--AAGGCCA---CUACGUAAA-----------AAACCAAA------ACAAAACAAUUCCCGAACGCGAA---------------------------------------------------------AUCGCUCUCGCUGCUUAAUUAA--CGCAGCGA----------------------------------------------CGUCCUACCCGGUUU------------------GCCUGUAGGCUGGGAUAGGGCG----------------------------------------------------------UAAGACAUACAGGAUA--GGAGGUUGCCAAC------------CUCCCCU-GAGGUAACCUCCGAAACUCUACGGGGA--UA-------GCUUCUCUCC-UCCUGCCUGUGGGAAAGAGAGAAGC------GAAA-CUCAAA----CACAGGCUAAGCA-UGUAG-----------------------AUGCCCUACUGC-UUAGGCUCUUGUCGGAC-GGGGGUUCGAUUCCCCC-CGCCUCCACuc Saz1t1
THERMOTOGAE
Tma4t3      GGGGGCG------AACGGG--UUCGACGGGGAUGGAGU------CCCCUGGGAAGCGAGC--CGAGG-UCCCCACCU--CCUCGUAAAA----------AAGGUGGG-ACAAAGAAUAAGUGCCAACGAACCUGUU------------------------------------------------------------GCUGUUGCCGCUUAAUAGAUAAGCGGC------------------------------------------------CGUCCUCUCCGAAGUU-----------------GGCUGGGCUUCGGAAGAGGGCG----------------------------------------------------------UGAGAGAUCCAGCCUA--CCGAUUCAG-CUUC-----------GCCUUCCGGCCUGAAUCGG-GAAAACUCAGGAAGGC-UG------UGGGAGAGGACACCCUGCCCGUGGGAGGUCCCUCCCG-------AGAGCGAAAA----CACGGGCUGCGCU-CGGAG-----------------------AAGCCCAGGGGC----CUCCAUCUUCGGAC-GGGGGUUCGAAUCCCCC-CGCCUCCACCA Tma4t3
Tma4t1      NNNNNNN------NNNNNN--NNNNNNGGGGAUGGAGU------CCCCUGGGAAGCGAGC--CGAGG-UCCCCACCU--CCUCGUAAAA----------AAGGUGGG-ACAAAGAAUAAGUGCCAACGAACCUGUU------------------------------------------------------------GCUGUUGCCGCUUAAUAGAUAAGCGGC------------------------------------------------CGUCCUCUCCGAAGUU-----------------GGCUGGGCUUCGGAAGAGGGCG----------------------------------------------------------UGAGAGAUCCAGCCUA--CCGAUUCAGGCUUC-----------GCCUUCCGGCCUGAAUCGG-GAAAACUCAGGAAGGC-UG------UGGGAGAGGACACCCUGCCCGUGGGAGGUCCCUCCCG-------AGAGCGAAAA----CACGGGCUGCGCU-CGGAG-----------------------AAGCCCAGGGGC----CUCCAUCUUCGGAC-GGGGGUUCNNNNNNNNN-NNNNNNNNNNN Tma4t1
Tne1t1      GGGGGCG------AACGGG--UUCGACGGGGAUGGAGU------CCCCUGGGAAGCGAGC--CGAGG-UCCCCACCU--CCUCGUAAAA----------AAGGUGGG-AACACGAAUAAGUGCCAACGAACCUGUU------------------------------------------------------------GCUGUUGCCGCCUAAUAGAUAGGCGGC------------------------------------------------CGUCCUCUCCGGAGUU-----------------GGCUGGGCUCCGGAAGAGGGCG----------------------------------------------------------UGAGGGAUCCAGCCUA--CCGAUCUGGGCUCC-----------GCCUUCCGGCCCGGAUCGG-GAAGGUUCAGGAAGGC-UG------UGGGAAGCGACACCCUGCCCGUGGGGGGUCCUUCCCG-------AGACACGAAA----CACGGGCUGCGCU-CGGAG-----------------------AAGCCCAGGGGC----CUCCAUCUUCGGAC-GGGGGUUCGAAUCCCCC-CGCCUCCACCA Tne1t1
THERMODESULFOBACTERIA
Tco1t1      GGGGGCG-----AAAAGGG--CUCGACGGGGAUAGGUA------GGAUUAAACAGCAGGC--CGUGG-UCGCACCCAA-CCACGUUAAA----------UAGGGUGC--AAAAACACAACUGCCAACGAAUACGCC---------------------------------------------------------UACGCUUUGGCAGCCUAAGCG---UGCUGCCA----------------------------------------------CGCACCUUUAGACCUU-----------------GCCUGU-GGGUCUAAAGGUGUG----------------------------------------------------------UGACCUA-ACAGGCUU--UGGGAGGCUUAAUC-----------GGUGGGG-UUAAGCCUCCCGAGAUUACA-UCCCACC-UG-------GUAGGGUUGCUUGGUGCCUGUGACAAGC-ACCCUAC------GAGA-UUUUCC----CACAGGCUAAGCC-UGUAG-----------------------CGGUUUAAUCUG----AACUAUCUCCGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Tco1t1
DEINOCOCCUS-THERMUS
Dra2t2      GGGGGUG-----ACCCGGU--UUCGACAGGGGA-ACUG-----AAGGUGAUGUUGCGUGU--CGAGG--UGCCGUUGG-CCUCGUAAAC----------AAACGGCA-AAGCCAUUUAACUGGCAACCAGAACUAC------------------------------------------------------------GCUCUCGCUGCUUAAGUGAGA------------------------------------------------------UGACGACCGUGCAGCCCG----------------GCCUUUGGCGUCGCGGAAGUCA---------------------------------------------------------CUAAAAAAGAAGGCUA--GCCCAGGCGAUU-------------CUCCAUA----GCCGACGGC-GAAACUU-UAUGGAGC-UAC-----GGCCUGCGAGAACCUGCCCACUGGUGAGCGCCGGCC------CGACAAUCAAA---CAGUGGGAUACACA-CGUAG-----------------------ACGCACGCUGG-----ACGGACCUUUGGAC-GGCGGUUCGACUCCGCC-CACCUCCACCA Dra2t2
Dge1t2      GGGGGUG-----ACCCGGU--UUCGACAGGGGA-ACUG-----AAGGUGAUGCUGCGUGU--CGAGG--UGCCGUUGG-CCUCGUGAAC----------AAACGGCA-AAGCCA-UUAACUGGCAACCAGAACUAC------------------------------------------------------------GCUCUCGCUGCUUAAGUGAGA------------------------------------------------------CAGUGACCGCCGAGCCCG----------------GCCUUUGGCGCGGCGCGAACUG---------------------------------------------------------AACCAAAAGAAGGCUA--GCCCCGGCGAGG-------------UUCCAUA----GCCGCAGGC-GAAACUC-CAUGGAAA-UAC-----GGUCUGGGCGAGCCUGCCCGCUGGCGCUCCCCGACC------CGACAACAAAA---AAGCGGGCUACACA-CGUAG-----------------------ACGCACGCUGG-----AAGGACUCUUGGAC-GGCGGUUCGACUCCGCC-CACCUCCACCA Dge1t2
Tth6t5      GGGGGUG-----AAACGGU--CUCGACGGGGGUCGCCG-----AGGGCGUGGCUGCGCGC--CGAGG--UGCGGGUGG-CCUCGUAAAA-----------ACCCGCA---ACGGCAUAACUGCCAACACCAACUAC------------------------------------------------------------GCUCUCGCGGCUUAAUGACCGCGA---------------------------------------------------C-CUCGCCCGGUAGCCCU----------------GCCGGGGGCUCACCGGAAGCGGGG--------------------------------------------------------ACACAAACCCGGCUA--GCCCGGGGCCAC-------------GCCCUCUA--ACCCCGGGC-GAAGCUUGAAGGGGGC-UCG--------CUCCUGGCCGCCCGUCCGCGGGCCAAGCCAGGAG-----GACACGCGAAA-----CGCGGACUACGCG-CGUAG-----------------------AGGCCCGCCGU-----AGAGACCUUCGGAC-GGGGGUUCGACUCCCCC-CACCUCCACCA Tth6t5
Tth6t6      GGGGGUG-----AAACGGU--CUCGACGGGGGUCGCCG-----AGGGCGUGGCUGCGCGC--CGAGG--UGCGGGUGG-CCUCGUAAAA-----------ACCCGCA---ACGGCAUAACUGCCAACACCAACUAC------------------------------------------------------------GCUCUCGCGGCUUAAUGACCGCGA---------------------------------------------------C-CUCGCCCGGUAGCCCU----------------GCCGGGGGCUCACCGGAAGCGGGG--------------------------------------------------------ACACAAACCCGGCUA--GCCCGGGGCCAC-------------GCCCUCUA--ACCCCGGGC-GAAGCUUGAAGGGGGC-UCG--------CUCCUGGCCGCCCGUCCGCGGGCCAAGCCAGGAG-----GACACGCGAAA-----CGCGGACUACGCG-CGUAG-----------------------AGGCCCGCCGU-----AGGGACCUUCGGAC-GGGGGUUCGACUCCCCC-CACCUCCACCA Tth6t6
CHLOROFLEXI
Cau1t3      GGGGAUG-----CUCUGGU--UUCGACAGGGAGUGAAC------GCCGUAGACUGCAGGU--CGUGC--CGCCC--AG-UCACGUAAAA------------GGGGCA---AGGCAACAACUGCCAACACCAACACU------------------------------------------CGGGCCCAGGCUCGCCUGGCCCUCGCCGCUUAAUAAUAGCGGCG-------------------------------------------------CGCUCGCC--GUAGCUCC----------------CCCGAUGGUUACGGGUCGAGCG----------------------------------------------------------UCAGC-AGUCGGGUGCUCCGGUAACGCCU-------------GCCUGA---GCGUUAUCGG--CUAAGAGAUCAGGC--UG------GCCCAACGGUCGCUUUGCCACUCGUGCGACUGCGGGU-------GAGAUGAAA----CGAGGGGCUAAACC-UGUAG-----------------------AUGUCUGCGGU-----CUAGCUUUCUGGAC-GGGGGUUCGACUCCCCC-CAUCUCCACCA Cau1t3
Tro2t1      GGGGAUG------ACUGGA--UUCGACAGGGCCGUAGG------UGCGAGGAUUGCAGGU--CGAG-GUCGCCCACGAA-CUCGUAAAAA----------GGGGCA----GCCAAGUAACUGGCGAGCGCGAA------------------------------------------------------------CUCGCUCUGGCUGCGUAAUUCACGCAGCCA------------------------------------------------CGUCUGCCCGGACCCUU----------------CCCUGGUGGGUUCGGAGCGGGCG---------------------------------------------------------CCGCAAGACCGGGGUGCCCCUGGCCCAAGC-------------GCCGGU---GCGGGCCAGGUCAAGCGUGAUCCGGC--UCG------GCUGACCGGGAUCCUGUCGGUGGGAGCCUGGCAGC--------GACAGUAGA----ACACCGACUAAGCC-UGUAG-----------------------CAUAUCCUCGG----CUGAACGCUCUGGAC-GGGGGUUCGACUCCCCC-CAUCUCCACCA Tro2t1
Det1t3      GGGGACG------CGUGGU--UUCGACAGGGAAGGUAG-----GCUACUGGAUUGCAGGC--UGAGGU-GCCAUCC--ACCUCAUUAAACA---------GGUGGC----AAAAAACAACUGGCGAACGUGAA------------------------------------------------------------CUCGUUCUUGCUGGCUAAAUAAGACAGCA-------------------------------------------------CAUCCUGCUUGGCCC----------------CACCUCAACGGGUCAGGUUUGGGUG----------------------------------------------------------CCGAUUAGUUGAGGUGCCGUUUCCCCAAC-------------GCCGAU---GAGGGGGACG--AAAGAAAUAUCGGC--UG------GUUUGGCUAAAUUAGG-CCGGCAAAAGCUAGCCAGAC-------AAGAUUAAA----UAGACGGAUAAUCC-UGUAG-----------------------UAGAUCCUGGG----UCACCUUUUCUGGACGGGGAGUUCGACCCUCCCCCGUCUCCACCA Det1t3
NITROSPIRAE
Lfe8t1      NNNNNNN-----NNNNNNN--NNNNNNGGGGAUGAGA------AAGCAAGAAUCGCAUGC--CGAGGA-CUCCUGGC-UCCUCGUAAA----------UCAUCCGGGA-AACAACACAACUGCCAACAACGAAAUG------------------------------------------------------------GCACUUGCUGCCUGA--------------------UCUAAA-AGUCAGGUGAGCUAG------------------CGUCUACCGGUACCAGUG----------------CCUGUCCUGGUCCGGAGGCG------------------------------------------------------------UCGAGAUGACAGGAUG-GCUUCCGGAACCC-------------GCCUGGGUUCCGCUAGC--GACACAGAU-CCAGGC-UCG-----CGGCGAAA-AGGGUGUGUCCUUUCU-CCCU--CUAGUG-----GCCAGACAAAAA---AAAGGGCUAAGCA-UGUAG---------------------------UGGUUCUUAGCGGACUGUUUCCGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Lfe8t1
Lgr1t7      GGGGGCG------AUCGGG--UUCGACGGGGAUGAGA------AAGCAAGGACAGCAUGC--CGAGG--UCCCAGGU--CCUCGUAAA----------ACCUUUGGGA--AAAAGACAACUGCCAACGAAGAGCUG------------------------------------------------------------GCUCUCGCUGCUUAA--------------------UCUAAACAAUUAAGUGAGCG--------------------CGCUUAUCGGAUUUUGCG----------------CCUGCCCGGAUCCGAAGGCG------------------------------------------------------------UGGAGAAGGCAGGAUC-GCCAAGGGAACAU-------------GCCUGGGUUCCCGAGGU--UAAACCCUU-ACAGGC-UC------GCUGAUGA-CGGGUACGCCCCUCUUUCCCGUCGUUGGU-------CAGACUUAAA---CAGGGGCUAAGCA-UGUAG---------------------------CGGUUCUUGGCGGACUGUUUCCGGAC-GCGGGUUCAAUUCCCGC-CGCCUCCACCA Lgr1t7
Lgr3t1      GGGGGCG------AUCGGG--UUCGACGGGGAUGAGA------AAGCAAGGACAGCAUGC--CGAGG--UCCCAGGU--CCUCGUAAA----------ACCUUUGGGA--AAAAGACAACUGCCAACGAAGAGCUG------------------------------------------------------------GCUCUCGCUGCUUAA--------------------UCUAAACAAUUAAGUGAGCG--------------------CGCUUAUCGGAUUUUGCG----------------CCUGUCCGGGUCCGAAGGCG------------------------------------------------------------UGGAGAAGGCAGGAUC-GCCAAGGGAACAU-------------GCCUGGGUUCCUGAGGU--UAAACCCUU-ACAGGC-UC------GCUGAUGA-CGGGUACGCCCCUCUUUCCCGUCGUUGGU-------CAGACUUGAA---CAGGGGCUAAGCA-UGUAG---------------------------CGGUUCUUGGCGGACUGUUUCCGGAC-GCGGGUUCAAUUCCCGC-CGCCUCCACCA Lgr3t1
Tye1t1      GGGGGCG------AAAGGA--CUCGACGGAGGUAGUG------AGGGCUAAGCUGCAUGC--CGUGG--UUCCUGCCA-CCACGUAAAAC---------AGGUAGGGA---AAACACAACUGCCAACAACGAAUUG------------------------------------------------------------GCACUCGCUGCUUAA--------------------UUAAAAGCAGC-----------------------------CGUCUUCCCAAGUUCUG-----------------CUCUGAGGCUUGGGCAAGGCG-----------------------------------------------------------UCAUAAAUCAGAGCUA-UCCUAAGGCACA--------------AACCCGAUGCCUUAGGG--AGAGCUAA---GGGUUGUA------GGAGCUUAGAGAGCCUGUGGAAGGGCGAGCUAACUUCC------GAAUCCUAAAA---CUUCCACUAAGCA-UGUAG----------------------------AUGCUUAGAAGUAGCACCUUCGGAC-GCGGGUUCGAUUCCCGC-CGCCUCCACCA Tye1t1
BACTEROIDETES/CHLOROBI
Bfr8t12     GGGGUUG------ACUGGU--UUUGACAGCGGGCAGAA-----AUGGUGGGUAAGCAUGC--AGUGCG-UCGGUGAUUUGCACUUUAAUCU--------CAGUUAUC--AAAAUUUUAUCUGGCGAAACUAAUUAC------------------------------------------------------------GCUCUUGCUGCUUAAUCGAAUCAUAGUAGAUUAG----------CUUAAUCCAGGCACCAGGUGCCAG-GACGAGACAUCACUCGGAA-GCUGUU-------------GCUCCGAAGCAUUCCGGUUCAGUGGUGCA----------------------------------------------------GUUACAUCGGGGAUA--GUCAGAAGUGG---------------CCUU--GCGCUUCUGAUGAAACUUUA---AAGGAUAAG------GCAGGAA--UUGAUG-GCUUUGGU-UCUGCUCCUGCACG---------AAAAACUUAGGCAAAGAUAAGCA-UGUAG----------------------AAAGCUUAUGAU-----UUCCUCGUUUGGAC-GAGGGUUCGAAUCCCUC-CAGCUCCACuu Bfr8t12
Bfr1t9      GGGGUUG------ACUGGU--UUUGACAGCGGGCAGAA-----AUGGUGGGUAAGCAUGC--AGUGCG-UCGGUGAUUUGCACUUUAAUCU--------CAGUUAUC--AAAAUUUUAUCUGGCGAAACUAAUUAC------------------------------------------------------------GCUCUUGCUGCUUAAUCGAAUCAUAGUAGAUUAG----------CUUAAUCCAGGCACCAGGUGCCAG-GACGAGACAUCACUCGGAA-GCUGUU-------------GCUCCGAAGCAUUCCGGUUUAGUGGUGCA----------------------------------------------------GUUACAUCGGGGAUA--GUCAGAAGUGG---------------CCUU--GCGCUUCUGAUGAAACUUUA---AAGGAUAAG------GCAGGAA--UUGAUG-GCUUUGGU-UCUGCUCCUGCACG---------AAAAACUUAGGCAAAGAUAAGCA-UGUAG----------------------AAAGCUUAUGAU-----UUCCUCGUUUGGAC-GAGGGUUCGAAUCCCUC-CAGCUCCACuu Bfr1t9
Bth28t1     GGGGUUG------ACUGGA--UUUGACAGCGGGCAGAA-----AUGGUAGGUAAGCAUGC--AGUGGG-UCGGUAAUUUCCACUUAAAUCU--------CAGUUAUC--AAAACUUUAUCUGGCGAAACUAAUUAC------------------------------------------------------------GCUCUUGCUGCUUAAUCGAAUCACAGUAGAUUAG----------CUUAAUCCAGGCACUAGGUGCCAG-GACGAGACAUCACUCGGAA-GCUGUU-------------GCUCCGAAGCAUUCCGGUUCAGUGGUGCA----------------------------------------------------GUAACAUCGGGGAUA--GUCAGAAGCGG---------------CCUC--GCGUUUUUGAUGAAACUUUA---GAGGAUAAG------GCAGGAA--UUGAUG-GCUUUGGU-UCUGCUCCUGCACG----------AAAAUUUAGGCAAAGAUAAGCA-UGUAG----------------------AAAGCUUAUGAU-----UUCCUCGUUUGGAC-GAGGGUUCGAUUCCCUC-CAGCUCCACCu Bth28t1
Tfo1t1      GGGGCUG------ACCGGU--UUUGACAGCGGGCAGAA-----GUGGUUUGUAAGCAUGC--AGUGCG-UCGUUGGCCGGCACUUUAAUCU--------CGGUUGAU--CCAAUUUUAACUGGCGAAAAUAACUAC------------------------------------------------------------GCUCUCGCUGCUUAAUCGAAGCACAGUAGAUUGAAG--------CUUAAUCCUUACACAAGGUGUUUG-GACGAGACAUCACCCGGAA-GCCGUG-------------GCUUCGAGGCAAUCCGAACCGGUGGUGCA----------------------------------------------------GAAAUGUCGGAGAUA--GCUUGACGGAUG--------------UCCC--GUACGGCAAGUGAAAAUUCA---GGGAAUAAG------GUUGCGG--UGGGUG-GCUUCGGU-CUUGCCGCAGCACG----------AAAAUGAAGGCGAAGAUAAGCA-UGUAG----------------------AAAGCAAAUUAG-----UUCCUCGUUUGGAC-GAGAGUUCGAAUCUCUC-CAGCUCCACau Tfo1t1
Pgi7t4      GGGGCUG------ACCGGC--UUUGACAGCGUGAUGAA-----GCGGUAUGUAAGCAUGU--AGUGCG-UGGGUGGCUUGCACUAUAAUCU--------CAGACAUC--AAAAGUUUAAUUGGCGAAAAUAACUAC------------------------------------------------------------GCUCUCGCUGCGUAAUCGAAGAAUAGUAGAUUAG-------ACGCUUCAUCGCCGC-CAAAGUGGCAGCGACGAGACAUCGCCCGAGCAGCUUU--------------UUCCCGAAGUAGCUCGAUGGUGCGGUGCU----------------------------------------------------GACAAAUCGGGAACC--GCUACAGGAUG---------------CUUCCUGCCUGUGGUCAGAUCGAAC---GGAAGAUAAG------GAUCGUGCAUUGGGUCGUUUCAGCCUCCGCUCGCUCACG---------AAAAUUCCAACUGAAACUAAACA-UGUAG----------------------AAAGCAUAUUGA-----UUCCAUGUUUGGAC-GAGGGUUCAAUUCCCUC-CAGCUCCACCA Pgi7t4
Pin5t2      GGGCUUG------UAUGGA--UUUGACGGCAAGACGAA-----AUGGUAUGUAAGCAUGC--GGAGCA-UUGGUAGCUGGCUCCUAAAUAU--------CGGUUAUC--AAACAAUUAAUUGGCGAAAACAAUUAC------------------------------------------------------------GCUCUCGCUGCCUAAUCGAAGUACAGUAGAUUAC-------UGGCUUUAUUCGACU-AUUAGAUAGUUGAACGAGACACUGCUCCAAA-GAUGUU-------------GUUCCGAAUCGGAGG-GUAAAGCGGUGCAG---------------------------------------------------GUUAAAUCGGAAAUA--GUUUGGGUAUG---------------CCUC-GCUGCCCAAAUGAAAUUUA-----GAGGAUAAG---------GCAUUGGUUGGUGGUUCAGGUCUUGCCAAUGCUCG----------AAAACCAAAGGCUGAAAUAAGCA-UGUAG----------------------AAAGCGUAUGGU-----UUCCUUGUGCGGAC-CGGAGUUCGACUCUCCG-CAGGUCCACua Pin5t2
Pru1t1      GGGGUUG------ACUGGA--UUUGACGGCGAGAUGAA-----AUGGUACGUAAGCACGC--GGAGGCUUCUUUGGUUCCCUCCAUAAUCU--------GAGUCAAGGAA--AAUUUAAUUGGCAACAAUGAGUAU------------------------------------------------------------GCUCUCGCUGCCUAAUCGAAGUAUAGUAGAUUAC-------UGGCUUUAUUCCUUU-ACAAGGUAGAGGAACGAGACGUCGCUCCGAG-GAUGUU-------------GUUCCGAAUCCAAAG-AUCAAGCGGCGCAG---------------------------------------------------GUUAAAUCGGAAAUA--GUCGUUGCAGA---------------CUCC-GAUGUAGCGGUGAAAUUUUA----GGAGAUAAG---------GUUGCGGUUGGUGGCUUGGGUCUUGCCGCAGCUCG-----------AAAAUGAAGGCCAAGAUAAGCG-UGUAG----------------------AAAGCGUAUGGU-----UUCCUUGUGCGGAC-GAGGGUUCGACUCCCUC-CAGCUCCACua Pru1t1
Chu1t1      GGGGUCG------ACAGGA--AUUGACAGGUUGAGUGA----UUACGUGUGUAAGCAUGC--AGGCUC-AUGGGAUGAGAGCCUUAAAAGA--------UAGUUCCG----AACAAUAAUUGGCGAAGAAUCUUAC------------------------------------------------------------GCCAUGGCUGCUUAAUUACGAACUAAGUUUGUAAUAAUGAGCGUUGAGUGGAGCUGUUAAGAACAGCACCCGGCCACAUCUCACACGG-CUUCU--------------GUUCUGCGGGCUGUG--AACUGAGAUGUC-----------------------------------------------------GAACAGCAGGACUAGGGGAGUACA-----------------AGUUGCGGGUGCUUC---GCGAAAUUAA--GUAACUAA-------GGUUAUAG-UUGGGU-GCCGGUGA-CCUGCUACAGCUCG----------AAAAUGAACAUCCGGCUAAGCA-UGUAG----------------------AAGAUUCGAUAG----UGGCCUUCUCUGGAC-GAGAGUUCGAAUCUCUC-CGACUCCACCA Chu1t1
Sru1t1      GGGGAUG-----ACACGGC--UUCGACGUGUAGUAAGC---GUGCAGCAGACUGACCUGC--CGAGC-AGCCUGAUUCGCUUCGUAAAACC--------UGUCAGG-----AACUGUAACUGCGGACGAUUAUUCG---------------------------------------------------------UACGCGAUGGCGGCGUAA--------CAGCCCCCAUC------------------------------------------UGUCUCGCGUCGCUCCU---------------GGCCCUUGGGGAGCGUGAGACAUC---------------------------------------------------------GACAAAAAGGGUGUA--GCCGCCGCGUUCUCC----------GACUG-CGGAUGCGCCGGUGAAAUCUAAU--CAGUCUCA-----GCGCCGCCCUGGCCUU-GUGAAUGGGCA-GACGGGCGACGU------GAACCGCCAAUGCAUUCACUAUGCA-GGUAG----------------------AGGUUUGCCUGU-----GCGGCUACACGGAC-CCGGGUUCGACUCCCGG-CAUCUCCACaa Sru1t1
Cte2t2      GGGGAUG------ACAGGC-UAUCGACAGGAUAGGUGU-----GAGAUGUCGUUGCACUC-CGAGUUUCAGCAUGGACGGACUCGUUAAACAA------GUCUAUG----UACCAAUAGAUGCAGACGAUUAUUCG---------------------------------------------------------UAUGCAAUGGCUGCCUGAUUAGCACAAGUUAAUUCAGAAGCCAU----------------------------------CGUCCUGCGGUGAAUGC-----------GCUUACUCUGAAGCCGCCGGAUGGCAUAACCCGCGCUUGA---------------------------------------GCCUACGGGUUCGCGCAAGUAAGCUCCGUACAUUCAUG------------CCCGAGGGGGUGUGCGGGUAACCAA------UCGGGAUA-------AGGGGACGAACGCUGCUGGCGGUGUAAUCGGACCAC---------GAAAAACCAACCACCAGAGAUGAG-UGUGG----------------------UAACUGCAUCGA-----GCAGUGUCCUGGAC-GCGGGUUCAAGUCCCGC-CAUCUCCACCA Cte2t2
Cch3t1      GGGGAUG------ACAGGC-UUUCGACAGGGUAGGUGU-----AAGGUGGCGUUGCACUC-CGAGUUUCAGCAUGGAUGGACUCGUUAAAGAA------GUCUAUG---CAACCUUUAGAUGCAGACGAUUAUUCG---------------------------------------------------------UAUGCAAUGGCUGCCUAAUUAGCAAAAGUUAAUUAACCAGCCAU----------------------------------CGCUCUUCAGCGGAGGC-----------GCUUACUCCAAGGCUGUUAGAGUGGCAUAAUUCGCGCUUGA-----------------------------------------GCUCUGCUCGCGCAAGUAAGCUCCGUUUUGUAUUG------------CCUGAUGUGCUUAGCGGGUAUUUAU------UCGGGAUA-------GUAAGUUGAACGUUACAAGUGUCGUACCAACUUAU----------GAAUCUUAA-ACACUUGAGAUGAG-UGUGG----------------------UAGCGUUAUCAA-----GCAAUAUUCUGGAC-GCGGGUUCGAAUCCCGC-CAUCUCCACCA Cch3t1
PLANCTOMYCETES
Gob1t1      GGGGGCG-----AUCUGGU--AUCGACCGGGUGUCGGA-----AGUGUUCGGUGGCGUGU--CGUGGUUGAUCAGCUGGCCACGUAAAA----------AGCCGAUC---AAAAUUUAACUGCUGAACCGCAGUAC------------------------------------------------------------UCCCUCGCGGCUUAAGUGCCGAGAGCCGUU---------------------------------------------CUGGCAGCUUC----------------------GCCUGAGAGGUGCUAG-UCCGG---------------------ACGCAAGUCAGGCUCGCGGGAACUCGAGGAGAGGGGACAACCACCCGAUCCGCCUCGGCGGCCGUUCCUGCUAAAAAAAUCUGGCCGAU-AGUUGUGUCGGGGUCCCGCUCGUAGGAACCCGGUAACAACGAACGUGCGGCGGCCCGUUAAACGGUGCGCCGCAG-------------GAAUAUACGAGCUACACA-CGUAG----------------------AUGCCGGCGCGGA-----AGCGCCUCGGGAC-CGGGGUUCGAUUCCCCG-CGCCUCCACuc Gob1t1
Rba1t3      GGGGGCG-----ACUUGGA--AUCGACCGGAUGUCAAG----AAGCGUAUGCCUGCGUGU--CGUGGUUGAUCAGUUGGCCACGUAAAA----------AGCUGAUCAAAAACUUUUAGUUGCAGAAGAAAACUUU------------------------------------------------------------GCACUGGCCGCCUAAUUACAGGUAGCC--CGGAC-----------------------------------------UGAUGGGGAUCGCCGAUGUC--------------GCCUGAAUGUCCGUCACAAUGUCGGA------------------------------------------------------------UCGUGGCCCGUCUUACUCAAG----------ACGCGGGUCGCUAAACAAGAUUUGAGUUAGCGGAUUCGGGAGCCUGUCAGGUAGCGCCCGAUGAAGCGAAAAGGAAUCUUCGAGAUUCCAC------------AAAUAGCUUGACUACACA-UGUAG----------------------ACGGCAUCGUGGA-----UGCAUCGCGGGAC-GGGAGUUCAAUCCUCCC-CGCCUCCACuu Rba1t3
CHLAMYDIAE/VERRUCOMICROBIA
Ctr19t21    GGGGGUG-----UAAAGGU--UUCGACUUAGAAAUGAA-------GCGUUAAUUGCAUGC--GGAGGGCGUUGGCUGG-CCUCCUAAAA----------AGCCGAC---AAAACAAUAAAUGCCGAACCUAAGGCU---------------------GAAUGCGAAAUUAUCAGCUUCGCUGAUCUCGAAGAUCUAAGAGUAGCUGCUUAAUUAGCA-AAGUUGUUACCUAAAUA-----CGGGUGACC----------------------CGGUGUUCGCGAGCUCC-----------------ACCAGAGGUUUUCGAAACACCG----------------------------------------------------------UCAUGUAUCUGGUUA--GAACUUAGGUCCUUUA---------AUUCUCGAGGAAAUGAGUUU-GAAAUUUAA-UGAGAGU-------CGUUAGUCUCUAUAGGGGUUUCUAGCUGAGGAGACAUAACG-------UAUAGUAC-CUAGGAACUAAGCA-UGUAG----------------------AGGUUAGCGGGGA-----GUUUACUAAGGAC-GAGAGUUCGACUCUCUC-CACCUCCAuag Ctr19t21
Ctr3t34     GGGGGUG-----UAAAGGU--UUCGACUUAGAAAUGAA-------GCGUUAAUUGCAUGC--GGAGGGCGUUGGCUGG-CCUCCCAAAA----------AGCCGAC---AAAACAAUAAAUGCCGAACCUAAGGCU---------------------GAAUGCGAAAUUAUCAGCUUCGCUGAUCUCGAAGAUCUAAGAGUAGCUGCUUAAUUAGCA-AAGUUGUUACCUAAAUA-----CGGGUGACC----------------------CGGUGUUCGCGAGCUCC-----------------ACCAGAGGUUUUCGAAACACCG----------------------------------------------------------UCAUGUAUCUGGUUA--GAACUUGGGUCCUUUA---------AUUCUCGAGGAAAUGAGUUU-GAAAUUUAA-UGAGAGU-------CGUUAGUCUCUAUAGGGGUUUCUAGCUGAGGAGACAUAACG-------UAUAGUAC-CUAGGAACUAAGCA-UGUAG----------------------AGGUUAGCGGGGA-----GUUUACUAAGGAC-GAGAGUUCGACUCUCUC-CACCUCCAuag Ctr3t34
Ctr11t1     GGGGGUG-----UAAAGGU--UUCGACUUAGAAAUGAA-------GCGUUAAUUGCAUGC--GGAGGGCGUUGGCUGG-CCUCCUAAAA----------AGCCGAC---AAAACAAUAAAUGCCGAACCUAAGGCU---------------------GAAUGCGAAAUUAUCAGCUUCGCUGAUCUCGAAGAUCUAAGAGUAGCUGCUUAAUUAGCA-AAGUUGUUACCUAAAUA-----CGGGUGACC----------------------CGGUGUUCGCGAGCUCC-----------------ACCAGAGGUUUUCGAAACACCG----------------------------------------------------------CCAUGUAUCUGGUUA--GAACUUGGGUCCUUUA---------AUUCUCGAGGAAAUGAGUUU-GAAAUUUAA-UGAGAGU-------CGUUAGUCUCUAUAGGGGUUUCUAGCUGAGGAGACAUAACG-------UAUAGUAC-CUAGGAACUAAGCA-UGUAG----------------------AGGUUAGCGGGGA-----GUUUACUAAGGAC-GAGAGUUCGACUCUCUC-CACCUCCAuag Ctr11t1
Cmu2t4      GGGGGUG-----UAAAGGU--UUCGACUUAGAAAUGAA-------GCGUUAAUUGCAUGC--GGAGGGCGUUGGCUGG-CCUCCUAAAA----------AGCCGAC---AAAACAAUAAAUGCCGAACCUAAGGCU---------------------GAAUGCGAAAUUAUCAGCUUCGCUGAUCUUAAUGAUCUAAGAGUUGCUGCUUAAUUAGCA-AAGUUGUUACCUAAGUA-----CUGGUAACC----------------------CGGUGUUCGCGAGCUCC-----------------ACCAGAGGUUUUCGAAACGCCG----------------------------------------------------------UCAUUUAUCUGGUUA--GAAUUAGGGCCUUUUA---------ACUCUCAAGGGAACUAAUUU-GAAUUUUAA-UGAGAGU-------CGUUGGUCUCUAUAGAGGUUUCUAGCUGAGGAGAUAUAACG-------UAAAAUAUUCUAGAAACUAAGCA-UGUAG----------------------AGGUUAGCGGGGA-----GUUUACUAAGGAC-GAGAGUUCGAAUCUCUC-CACCUCCAuag Cmu2t4
Cpn3t7      GGGGGUG-----UAUAGGU--UUCGACUUGAAAAUGAA-------GUGUUAAUUGCAUGC--GGAGGGCGUUGGCUGG-CCUCCUAAAA----------AGCCAAC---AAAACAAUAAAUGCCGAACCUAAGGCU---------------------GAAUGCGAAAUUAUUAGCUUGUUUGACUCAGUAGAGGAAAGACUAGCUGCUUAAUUAGCAAAAGUUGUUAGCUAGAUAAUCUCUAGGUAACC----------------------CGGUAUCUGCGAGCUCC-----------------ACCAGAGGCUUGCAAAAUACCG----------------------------------------------------------UCAUUUAUCUGGUUG--GAACUUACUUUCUCUA---------AUUCUCAAGGAAGUUCGUUC-GAGAUUUU--UGAGAGU-------CAUUGGCUGCUAUAGAGGCUUCUAGCUAAGGGAGUCCAAUG-------UAAACAAUUCUAGAAGAUAAGCA-UGUAG----------------------AGGUUAGCAGGGA-----GUUUGUCAAGGAC-GAGAGUUCGAGUCUCUC-CACCUCCAuua Cpn3t7
Cca2t1      GGGGGUG-----UAUAGGU--UUCGACUUGGAAAUGAA-------GUGUUAAUUGCAUGC--GGAGGGCGUUGGCUGG-CCUCCUAAAA----------AGCCGAC---AAAACAAUAAAUGCCGAACCUAAGGCU---------------------GAAUGCGAAAUUAUCAGUUUCUCUGACCUCACCGAGGAAAGAUUAGCUGCUUAAUUAGCAAAAGUUGUUGUCUAGAUAACCUCUAGAUAACC----------------------CGGUGCUCAUAGACUCC-----------------ACCAGAGGUUUGUGAAACACCG----------------------------------------------------------UCAUCUAUCUGGUUG--GAAUCUACCUUCUCUA---------AUUCUCAAGGAGGUUUAUUC-GAGAUUAU--UGAGAGU-------CGUUGGCUUCCAUAGAUGUUCUUAGCUGAGGAAGUUCAAUG-------UAUG-AUUACUAGGGACUAAGCA-UGUAG----------------------AGGUUAGCAGGGA-----GUUUACUAAGGAC-GAGAGUUCGAGUCUCUC-CACCUCCAuuu Cca2t1
Cab1t1      GGGGGUG-----UAUAGGU--UUCGACUUAGGAAUGAA-------GUGUUAAUCGCAUGC--GGAGGGCGUUGGCUGG-CCUCCUAAAA----------AGCCGAC---AAAACAAUAAAUGCCGAACCUAAGGCU---------------------AAAUGCGAAAUUAUCAGUUUCUCUGAACUCUCUGAGCAAAGAUUAGCUGCUUAAUUAGCAAAAGUUGUUAUUUAGAUAACCUCUAGAUAACC----------------------CGGUCUUCAUGGACUCU-----------------ACCAGAGGUUUGUGAAGUACCG----------------------------------------------------------UCAUCUAUCUGGUUG--GAAUCUACCUCCUCUA---------AUUCUCAAGGGGGUUUAUUC-GAGAUUAU--UGAGAAU-------CGUUGGUUUCCAUAGAUGUUCUUAGCUGAGGAAAUGCAACG-------UUAG-ACUACUAGGGACUAAGCA-UGUAG----------------------AAGUUAGCAGGGA-----GUUUACUAAGGAC-GAGAGUUCGAGUCUCUC-CACCUCCAuac Cab1t1
Pam1t1      GGGGGUG-----UUACGGU--UUCGACUAGGAAGUGAA-------AAAUUGAUUGCAUGC--GGAGGAUAUCGGUUGG-CCUCCUAAAAA---------AACCGGUA---AAACAAUAAAUGCUAACAAUAGCAAU------------------------AAAAUUGCAAAAGUUGACUUCCAGGAAGGGACUUUUGCUAGAGCUGCGUAAGACCUAA-----------------CAGUCUUGGUAGCC----------------------CGAUAGUCUGAAACUGG-----------------ACCGAGGGUUUUAGAAUCUAUCG---------------------------------------------------------UCAUUUUCUUGGUAU--GAAUUCUUUUUCUCGCC--------GCUUCUAGGGAAAAGUUUUC-AAGAUUAA--AUGAAGC-AAA-----CUAACUUCGAUUGUUGCGUUCUGCAUAGGAGUUAG-----------GGAU-UUUACAGAACGAUAAGCA-UGUAG----------------------UGGUCAAUUCGUA-----AUUUGCCAAGGAC-GAGAGUUCAAUUCUCUC-CACCUCCAauu Pam1t1
Vsp1t1      GGGGGCG-----UUCUGGU--UUCGACGGAUUGCUAGA------AGUGGAGGCUGCAUGC--CGCGGAUGAUUCGUUGGCCGCGUUACCAAUU------CGGAUCA---AACAAACUAAAUGCGAACUCUAACGAG---------------------------------------------------------CUUGCCCUCGCCGCUUAAUUGACGGUGA--------------------------------------------------CGUUCCUCCAGUGAA-------------------GUCUGUGAAUUGGAGGGGCG------------------------------------------------------------ACUACUUACAGGCUG--GCCAAAAGAGCG-------------GGCGACCGGCUCCGAGGC---GAGAUCUACAGGCCGCU-G-------GGUGGACGGUAUCCUGGCAGUAGGAGACUGGACAUC---------GAGAUCAAAU-UAUUGCCUGAGCA-UGGAG----------------------ACGCUUUCAUGGA-----AGGUGGUUCGGAC-AGGGGUUCAACUCCCCU-CGCCUCCACCA Vsp1t1
SPIROCHAETES
Bbu5t8      GGGGAUG-----UUUUGGA--UUUGACUGAAAAUGUU----AAUAUUGUAAGUUGCAGGC--AGAG-----GGAAU----CUCUUAAAAC---------UUCU---------AAAAUAAAUGCAAAAAAUAAUAAC------------------------------------------UUUACAAGCUCAAAUCUUGUAAUGGCUGCUUAA---------------------------GUUAGC---------------------------AGAGGGUUUUGUUGAAUUUG--------------GCUUUGAGGUUCACUUAUACUCUUU----------------------------------------------------UCGACAU--CAAAGCUUG--CUUAAAAAUGUU-------------UUCAAGUUGAUUUUUAGG--GACUUUUAUACUUGAG--A-------GCAAUUUGGUGGUUUGCUAGUAUUUCCAAACCAUAUUGC-UUAA-UA-------AAAUACUAGAUAAGCU-UGUAG----------------------AAGCUUAUAGUAU------UAUUUUUAGGAC-GCGGGUUCAAUUCCCGC-CAUCUCCAuuu Bbu5t8
Bga3t1      GGGGAUG-----UUUUGGA--UUUGACUGAAAAUGCU----AAUAUUGUAAGUUGCAGGC--AGAG-----GGAAU----CUCUUAAAAC---------UUCU---------AAAAUAAAUGCAAAAAAUAAUAAC------------------------------------------UUUACAAGCUCAAACCUUGUAAUGGCUGCUUAA---------------------------GUUAGC---------------------------AGAGAGUUUCGUUGAAUUUG--------------GCUUUGAGGUUCACUUAUACUCUUU----------------------------------------------------UCGACAU--CGAAGCUUG--CUUAAAAAUGUU-------------UUCAAGUUAAUUUUUAGG--GACUUUUGUACUUGAG--A-------GCAAUUUGGUGGUUUGCUAGUAUUUCCAAACCAUAUUGC-UUAAGUA-------AAAUGCUAGAUAAGCU-UGUAG----------------------AAGCUUAUAAUAU------UGUUUUUAGGAC-GCGGGUUCAAUUCCCGC-CAUCUCCAuuu Bga3t1
Tpa7t17     GGGGAUG-----ACUAGGU--UUCGACUAGGGAUGU-----GGGGUGUUGCGCUGCAGGU--GGAG--UGU-CGAU----CUCCUGAU-----------UCGGCG-----CCUUUAUAACUGCC---AAUUCUGAC------------------------------------------------AGUUUCGACUACGCGCUCGCCGCGUAA-----------------------------UCG----------------------------CGGG-CCUGUGUUUGCGCU---------------GCUCUGAGCGAACAUAUCGG-CCCG----------------------------------------------------ACGCCAA-ACGGAGCUUG--CUCUUACGUUGU-------------GCACGGCGGACGUAGGGG--GACUUUUGU-CUGUGC-UAA------GACUCUGG--CGCGUGCGGUGCAGGCCUAGCAGAGUC--CGACAAACGCAGUAC--GCACCGC-UAAACC-UGUAG----------------------GCGCGCAGCACUC------GCUCUUUAGGAC-GGGGGUUCGAUUCCCCC-CAUCUCCACaa Tpa7t17
Tde5t8      GGGGAUG-----UUCCGGU--UUCGACCGGAAAGAC-----GGAGGCUUAAGCUGCAGGC--GGAG---UGCCGAU----CUCCUGAU-----------UCGGCA----AACACUAUAACUGCCGAAAAUAACGAC------------------------------------------------AGUUUCGAUUACGCCUUAGCUGCAUAA-----------------------------UCG----------------------------CGGAAUCUGC-UUUGCACU---------------GCUCCGAGCGGG-GCAU-GAUUCCG----------------------------------------------------ACGCCAA-UCGGGGCUUG--CUUUUUAGCGGC-------------GUGUAAACGUUAAAAGG---GACUUUU--UUUACAC-UAA------GGAUUCGA--CGCUUUCGGUGCU-GC-UACCGGAUCC--CUACAACCACCUC----GCACCGA-UAAGCC-UGUAG----------------------ACGCUUCUGAUUC------CCUUUUCGGGAC-GGGGGUUCAAUUCCCCC-CAUCUCCAuca Tde5t8
Lin112t136  GGGGACG----AAAUUGGU--UUCGACUGUUGUUGC-----CAGGGGUUAUGUGGCGUGU--AGAGG-UUGUAGGCU--CCUCUAAAAA----------CCUUCAA------ACAAUAACCGCUAAUAACGAAUUA------------------------------------------------------------GCUUUAGCAGCUUAA---------------------------UCUCUGCUA------------------------CGGAACUUUAGUUUUUUC-------------UCUCGAAUUCUAAAUGUUCUG------------------------------------------------------------ACAAUGAUCGGGAGGCG--AUUCUUUUGGUU------------UUUGGUUCCUAAAAGAGU--UUGUAUUU--GAGCCGAAUA-------GGAAAGAGA-GUCCU-GUCUG-AGGGUGAACCUCUUUCC--GAAAUUUUAUACA-----CAGACUACACA-CGUAG----------------------AGGCUGAUCUGGG------GCGCAAUAGGAC-GCGGGUUCGAACCCCGC-CGUCUCCAaag Lin112t136
FIBROBACTERES/ACIDOBACTERIA
Fsu1t2      GGGGGUG-----CUCUGGU--UUCGACAGGGUUACC------GAAGUGUUAGUUGCAAGUCGAGGUC-UCAGACGAGGGCAACUCGUUAAAAA------GUCUGA----AAAAAAAUAAGUGCUGACGAAAACUAC------------------------------------------------------------GCACUCGCUGCCUAA--------------------------UUAACGGCAACG----------------------CCGGGCCUCAUUCCGC------------------UCCCAUCGGGAUGUACGUCCGG----------------------------------------------------------ACGCAAUAUGGGAUA--GGGAAGUGUCAU-------------GCCUGGGGGCAUCUCCC---GAGAUUUA--CUAGGC-UG------GUCAAACUCCGCGCCG-ACCUUCUUGGGCGUGGAUAAGAC----GAGAUCUU-AAAUACGAAGGGAACACU-UGUAG----------------------GAACGUACAUGG-----ACGUGAUUUUGGAC-AGGGGUUCGACUCCCCU-CACCUCCAgaa Fsu1t2
Aca3t1      GGGGGCG-----UCACGGU--UUCGACGGGAUUGAC------UGCGGCAAAGAGGCAUGCCGGGGG--GUGGGCA-------CCCGUAAUC--------GCUCGC----AAAACAAUACUUGCCAACAACAAUCUG------------------------------------------------------------GCACUCGCAGCUUAA--------------------------UUAAAUAAGUUG----------------------CCGUCCUCUGAGGCUUC-----------------GCCUGUGGGCCGAGGCAGGACG----------------------------------------------------------UCAUACAGCAGGCUG--GUUCCUUCGGCUGG-----------GUCUG-GGCCGCGGGGAU--GAGAUCCA---CGGAC-UA------GCAUUCUGCGUAUCUU--GUCGCUUCUAAGCGCAGAGUGC----GAAACCUA-AAGGAAUGCGACUGAGCA-UGGAG----------------------UCUCUUUUCUGAC-----ACCAAUUUCGGAC-GCGGGUUCGACUCCCGC-CGCCUCCACCA Aca3t1
Sus2t1      GGGGGCG-----UAACGGA--UUCGACGGGAUUGAA-----UCGUGGUGGGGAGGCGUGCCGGG----UUCCGAGCU-----CCCGUAAAA------CGAUCGGAA------AACAUAACUGCCAACACGCAGUUU------------------------------------------------------------GCAUACGCUGCUUAA-------------------------UUAAUUAAGUAGC----------------------CGUUCCAGCCACUGA------------------GCCUGCGCGGUGGUGAGUGAACG----------------------------------------------------------UCAUUUUGCAGGAUA--GGCCAAGAGCUUCG-----------GUCCG-GAGCUGGCGGCU--GAGACUCAAU-CGGGC-UA------AGCUGCCACCGCCCUU--GCCGGUUCAGG-GGUGGCCGCC----GACAACCA----UGAGCCGGAUACGCA-CGUAG----------------------UUCUCUCCAGUAC----GGGCUUUUUCGGAC-GGGGGUUCAACUCCCCC-CGCCUCCACCA Sus2t1
FUSOBACTERIA
Fnu2t2      GGGGAUG-----CAAAGGU--UUCGACGGGGUUGUGAG------GUUAUAGGUAGCAAGU--CAGGC--UUGUC----GCUGUGAGAGACUA-------AACACA------UCUUUUAGAUGGAAACAAAGAUUAC------------------------------------------------------------GCUUUAGCUGCUUAG------------------------UUCAGCUA----------------------------CACCUUGGAUAACUUAU---------------UCUAUACGGGUUUUUCAAAGGUG---------------------------------------------------------UUGACUAGUAUAGAUCA---CCAUAAAUGAU----------UUCUCUAA----GUUUAUGG-GACAUU----UUAGAGGA-UA---------GUUUUAGUUAGCCCUGUUUACGGGAGUAAUUAUUAC----GAAAUUUAAUA-----GUAAACUAAACU-UGUAG-----------------------AAGCUUAUGG---UCAUUAUGAUUUCGGAC-ACGAGUUCGACUCUCGU-CAUCUCCACCA Fnu2t2
Fnu3t2      GGGGAUG-----CAAAGGU--UUCGACGGGGUUGUGAG------GUUAUAGGUAGCAAGU--CAGGU--UUGUC----GCUGUGAAAGACUA-------AACACA------UCGUUUAGAUGGAAACAAAGAAUAC------------------------------------------------------------GCUUUAGCUGCUUAG------------------------UUCAGCUA----------------------------CACCUUGGAUAACUUAU---------------UCUAUACGGGUUUUUCAAAGGUG---------------------------------------------------------UUGACUAGUAUAGAUUA---CCAUAAAUGAU----------UUCUCUAA----GUUUAUGG-GACAUU----UUAGAGGA-UA---------GUUUUAGUUAGCCCUGUUUACGGGAGUAAUUAUUAC----GAAAUUUAAUA-----GUAAACUAAACU-UGUAG-----------------------AAGCUUAUGG---UCGUUAUGAUUUCGGAC-ACGAGUUCGACUCUCGU-CAUCUCCACCA Fnu3t2
Fnu4t1      GGGGACG-----CAAAGGU--UUCGACGGGGUUGUGAG------GUUAUAGGUAGCAAGU--CAGGU--UUGUC----GCUGUGAAAGACUA-------AACACA------UCGUUUAGAUGGAAACAAAGAAUAC------------------------------------------------------------GCUUUAGCUGCUUAG------------------------UUCAGCUA----------------------------CACCUUGGAUAACUUAU---------------UCUAUACGAGUUUUUCAAAGGUG---------------------------------------------------------UUGACUAGUAUAGAUUA---CCGUAAAUGAU----------UUCUCUAA----GUUUAUGG-GACAUU----UUAGAGAA-UA---------GUUUUAGUUAGCCCUGUUUACGGGAGUAAUUAUUAC----GAAAUCUAAUA-----GUAAACUAAACU-UGUAG-----------------------AAGCUUAUAG---UCAUUAUGAUUUCGGAC-ACGAGUUCGAUUCUCGU-CGUCUCCACCA Fnu4t1
DICTYOGLOMI
Dth2t1      GGGGGCG------AUUGGU--UUCGACAGGGAGUACAA----GGAUCAAAAGCUGCAAGC--CGAGG--UGCCGUUA--CCUCGUAAAAC---------AACGGCA-----AAAAAGAAGUGCCAACACAAAUUUA------------------------------------------------------------GCAUUAGCUGCUUAAUUU---AGCAGCUA----------------------------------------------CGCUCUU-CUAACCCG-----------------GGCUGGCAGGGUUAGAAGGGUG--------------------------------------------------------UCAUAAUGAGCCAGCUGC--CCCUUCCGAC---------------UCCCCUA----AGGAAGGG--AAAGAUG-UAGGGGA-UA-----GGUGCUUACAGAAUCCUGCGGGAGGGAGUCUGUAAGUGCC----GAAAAGUUAAAA---CUCCCGCUAAGCU-UGUAG-----------------------AGGCUUUUGAUU----CUUGCUCUCUGGAC-GCGGGUUCGACUCCCGC-CGCCUCCACCA Dth2t1